Mutagenetix > Incidental Mutation

Incidental Mutation 'R1967:Dnah11'

219094

Institutional Source

Beutler Lab

Gene Symbol

Dnah11

Ensembl Gene

ENSMUSG00000018581

Gene Name

dynein, axonemal, heavy chain 11

Synonyms

b2b598Clo, Dnahc11, b2b1289Clo, lrd, b2b1727Clo, b2b1203Clo, b2b1279Clo

MMRRC Submission

039980-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.458) question?

Stock #

R1967 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

117877982-118199043 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 117916788 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Aspartic acid at position 3866 (Y3866D)

Ref Sequence

ENSEMBL: ENSMUSP00000081867 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084806]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000084806
AA Change: Y3866D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000081867
Gene: ENSMUSG00000018581
AA Change: Y3866D

Domain	Start	End	E-Value	Type
low complexity region	18	28	N/A	INTRINSIC
Pfam:DHC_N1	218	794	1.6e-162	PFAM
low complexity region	1266	1282	N/A	INTRINSIC
Pfam:DHC_N2	1297	1705	1e-130	PFAM
low complexity region	1757	1773	N/A	INTRINSIC
AAA	1869	1963	1.51e0	SMART
Pfam:AAA_5	2150	2286	1.6e-12	PFAM
AAA	2474	2619	1.48e-1	SMART
AAA	2819	2931	4.57e-1	SMART
Pfam:MT	3069	3413	3.2e-162	PFAM
Pfam:AAA_9	3434	3656	2.9e-88	PFAM
Pfam:Dynein_heavy	3790	4486	7.1e-235	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175662

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176239

Predicted Effect

probably benign
Transcript: ENSMUST00000176756

Meta Mutation Damage Score

0.6879

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ciliary outer dynein arm protein and is a member of the dynein heavy chain family. It is a microtubule-dependent motor ATPase and has been reported to be involved in the movement of respiratory cilia. Mutations in this gene have been implicated in causing Kartagener Syndrome (a combination of situs inversus totalis and Primary Ciliary Dyskinesia (PCD), also called Immotile Cilia Syndrome 1 (ICS1)) and male sterility. [provided by RefSeq, Mar 2013]
PHENOTYPE: Approximately half of live-born homozygous mutants show situs inversus indicating that this gene is no longer properly controlling left-right asymmetry. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	G	15: 8,203,420	V1141G	probably benign	Het
4930447A16Rik	A	C	15: 37,439,598		probably benign	Het
4931408C20Rik	T	A	1: 26,683,373	I909L	probably benign	Het
Abca6	T	C	11: 110,187,148	I1278V	probably benign	Het
Adamts15	C	T	9: 30,921,309	W310*	probably null	Het
Adamts6	T	A	13: 104,426,951	C650*	probably null	Het
Akap3	G	T	6: 126,865,098	G227C	probably benign	Het
Alox12e	A	T	11: 70,317,856	S457T	probably benign	Het
Angpt1	C	A	15: 42,438,307	C435F	probably damaging	Het
Anxa9	T	C	3: 95,300,608	Q207R	probably benign	Het
Aplnr	A	T	2: 85,137,606	D325V	probably benign	Het
Art2b	A	C	7: 101,580,207	F162V	probably damaging	Het
Atp13a4	A	G	16: 29,479,854	S96P	probably damaging	Het
Bnc1	A	T	7: 81,973,636	H614Q	probably benign	Het
C6	A	G	15: 4,759,820	D249G	probably damaging	Het
Camta1	A	T	4: 151,088,973	F977I	probably damaging	Het
Chil6	T	C	3: 106,391,154	S188G	possibly damaging	Het
Cntrob	A	T	11: 69,320,963	L145Q	probably damaging	Het
Coro7	T	C	16: 4,634,889	E306G	probably damaging	Het
Cpq	T	C	15: 33,497,202	S363P	possibly damaging	Het
Ctc1	A	G	11: 69,027,862		probably null	Het
Defb43	T	A	14: 63,017,797	N26K	probably benign	Het
Dennd1a	T	C	2: 37,844,833	T41A	probably benign	Het
Eml6	A	G	11: 30,024,545	L11P	probably damaging	Het
Epha5	A	G	5: 84,416,429	V26A	probably benign	Het
Fam13c	A	G	10: 70,551,735	D443G	probably damaging	Het
Fam227a	G	A	15: 79,637,134	L243F	possibly damaging	Het
Fat3	T	G	9: 15,968,295	R3301S	probably benign	Het
Fbxw20	T	C	9: 109,217,510	T461A	probably benign	Het
Fgf8	T	A	19: 45,741,568	S61C	probably damaging	Het
Fgfrl1	A	G	5: 108,705,005	E100G	probably damaging	Het
Gabra4	G	A	5: 71,572,069	S456F	possibly damaging	Het
Gas6	T	C	8: 13,470,317	E457G	probably damaging	Het
Gm156	A	T	6: 129,775,835	N2K	possibly damaging	Het
Gpr33	G	A	12: 52,024,208	S16L	probably benign	Het
Greb1l	A	C	18: 10,501,049	N393T	possibly damaging	Het
Gtpbp4	T	C	13: 8,977,304	K492E	probably benign	Het
Hsf2bp	A	T	17: 31,987,404	L251*	probably null	Het
Hyal5	A	T	6: 24,876,194	Q22L	possibly damaging	Het
Itih1	A	T	14: 30,941,984	V114E	possibly damaging	Het
Jak3	T	A	8: 71,681,535	I427N	probably damaging	Het
Jcad	T	C	18: 4,675,162	S975P	probably benign	Het
Kcng4	A	G	8: 119,632,923	V238A	probably damaging	Het
Klb	A	G	5: 65,372,074	D315G	probably damaging	Het
Krt5	T	C	15: 101,711,659	N208D	probably benign	Het
Lmo7	T	A	14: 101,900,215	H551Q	probably benign	Het
Lrp8	G	T	4: 107,859,971	G732V	probably damaging	Het
Lrrc38	A	G	4: 143,369,983	D288G	unknown	Het
Lrrc4b	GAGAAG	GAG	7: 44,462,230		probably benign	Het
Mas1	A	G	17: 12,842,036	Y167H	probably benign	Het
Mcm8	A	C	2: 132,842,742	I759L	probably benign	Het
Med13l	G	A	5: 118,761,322	D2148N	probably damaging	Het
Muc20	A	T	16: 32,794,242	I255K	probably benign	Het
Myh1	A	G	11: 67,213,447	N980S	probably benign	Het
Nap1l4	T	A	7: 143,534,287	Q178L	probably damaging	Het
Ncapg	T	A	5: 45,699,910	L988Q	probably damaging	Het
Ncf2	A	T	1: 152,830,372	H245L	probably damaging	Het
Neurl4	A	G	11: 69,903,210	E164G	possibly damaging	Het
Nf1	G	A	11: 79,412,745	R416H	probably damaging	Het
Obscn	G	A	11: 59,135,709	Q223*	probably null	Het
Olfr1394	T	C	11: 49,160,848	I278T	probably benign	Het
Olfr1494	T	A	19: 13,750,053	*316R	probably null	Het
Pcdhb16	T	A	18: 37,479,662	N558K	probably damaging	Het
Pcnx2	A	T	8: 125,815,683	M1253K	possibly damaging	Het
Pla2g4a	A	G	1: 149,922,081	V22A	probably damaging	Het
Plppr5	G	A	3: 117,625,906		probably null	Het
Pnpla2	T	C	7: 141,459,432	S353P	probably benign	Het
Pom121	A	T	5: 135,391,754	L271Q	unknown	Het
Prepl	A	T	17: 85,088,551	M1K	probably null	Het
Prr14l	A	G	5: 32,844,469		probably benign	Het
Psmc3	C	A	2: 91,057,844	P325T	probably benign	Het
Psme2b	A	G	11: 48,946,069	V17A	probably damaging	Het
Ptpro	A	G	6: 137,416,865	I23V	probably benign	Het
Rab31	A	G	17: 65,772,504		probably null	Het
Ranbp6	T	A	19: 29,812,500	K151*	probably null	Het
Rbm12b1	A	T	4: 12,146,304	I759L	probably benign	Het
Rgs5	T	C	1: 169,676,856	I25T	probably benign	Het
Rnf213	T	C	11: 119,480,895	V4842A	probably damaging	Het
Rtl9	A	T	X: 143,103,041	I1150F	probably damaging	Het
Scn1a	A	T	2: 66,328,425	W384R	probably damaging	Het
Sema5a	C	T	15: 32,681,619	P948L	probably damaging	Het
Slc26a3	G	A	12: 31,465,778	R559Q	probably damaging	Het
Slc29a3	A	G	10: 60,716,464	V267A	probably benign	Het
Spata22	A	G	11: 73,331,127		probably benign	Het
Sptbn2	G	T	19: 4,745,299	R1595L	probably benign	Het
Tfdp1	T	C	8: 13,373,039	S315P	possibly damaging	Het
Tle1	A	T	4: 72,120,226	V688E	probably damaging	Het
Tmem129	A	T	5: 33,655,321		probably null	Het
Tmprss11a	G	A	5: 86,431,843	T91I	probably benign	Het
Tnfsf14	A	G	17: 57,190,807	Y142H	probably damaging	Het
Tph1	T	C	7: 46,662,114	D68G	probably benign	Het
Ttn	A	T	2: 76,762,287	S12507T	probably damaging	Het
Tubgcp2	T	A	7: 140,006,153	M408L	probably benign	Het
Usp34	A	T	11: 23,364,503	H815L	probably benign	Het
Usp6nl	G	A	2: 6,441,519	R746H	probably benign	Het
Utp20	A	G	10: 88,816,979	S358P	probably benign	Het
Vmn2r118	G	A	17: 55,592,882	T674I	probably damaging	Het
Vmn2r8	A	T	5: 108,802,383	H199Q	probably benign	Het
Vmn2r9	A	G	5: 108,847,522	V420A	probably benign	Het
Vmn2r99	A	T	17: 19,378,815	T254S	probably benign	Het
Zbed5	A	G	5: 129,901,669	H132R	possibly damaging	Het
Zfp568	A	G	7: 29,989,088	E25G	probably damaging	Het
Zfp951	T	A	5: 104,817,000	I67L	possibly damaging	Het

Other mutations in Dnah11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Dnah11	APN	12	118198745	missense	probably benign	0.28
IGL00422:Dnah11	APN	12	118068096	missense	probably damaging	1.00
IGL00436:Dnah11	APN	12	118036459	missense	possibly damaging	0.56
IGL00540:Dnah11	APN	12	118186922	missense	probably benign	0.01
IGL00687:Dnah11	APN	12	117922004	splice site	probably benign
IGL00833:Dnah11	APN	12	118179580	missense	probably damaging	1.00
IGL00906:Dnah11	APN	12	117911202	missense	probably damaging	1.00
IGL00952:Dnah11	APN	12	118196651	missense	possibly damaging	0.56
IGL01111:Dnah11	APN	12	118142934	splice site	probably benign
IGL01121:Dnah11	APN	12	118050695	missense	probably benign	0.02
IGL01143:Dnah11	APN	12	118012740	missense	probably damaging	1.00
IGL01359:Dnah11	APN	12	117982999	missense	probably damaging	0.99
IGL01372:Dnah11	APN	12	118192399	missense	probably damaging	1.00
IGL01410:Dnah11	APN	12	118047256	nonsense	probably null
IGL01418:Dnah11	APN	12	117987482	nonsense	probably null
IGL01444:Dnah11	APN	12	118020232	missense	possibly damaging	0.91
IGL01606:Dnah11	APN	12	117983032	missense	probably benign	0.15
IGL01645:Dnah11	APN	12	118186998	missense	possibly damaging	0.90
IGL01932:Dnah11	APN	12	118192270	splice site	probably benign
IGL02104:Dnah11	APN	12	118192390	missense	probably benign
IGL02151:Dnah11	APN	12	118059888	splice site	probably benign
IGL02189:Dnah11	APN	12	118082579	missense	probably benign	0.00
IGL02417:Dnah11	APN	12	118057180	missense	probably damaging	1.00
IGL02421:Dnah11	APN	12	118186902	missense	probably damaging	1.00
IGL02444:Dnah11	APN	12	117975873	splice site	probably benign
IGL02474:Dnah11	APN	12	118027445	splice site	probably null
IGL02526:Dnah11	APN	12	118179618	missense	possibly damaging	0.70
IGL02887:Dnah11	APN	12	117911040	missense	probably damaging	1.00
IGL03011:Dnah11	APN	12	118012377	missense	probably benign	0.08
IGL03061:Dnah11	APN	12	117903121	missense	probably damaging	1.00
IGL03182:Dnah11	APN	12	118030291	missense	probably damaging	0.99
IGL03220:Dnah11	APN	12	118105985	missense	probably benign
IGL03238:Dnah11	APN	12	118109898	missense	probably damaging	1.00
IGL03493:Dnah11	APN	12	118012798	missense	probably benign	0.00
P0045:Dnah11	UTSW	12	118030327	missense	probably benign
R0009:Dnah11	UTSW	12	118045522	missense	possibly damaging	0.90
R0066:Dnah11	UTSW	12	118126886	missense	probably benign	0.05
R0172:Dnah11	UTSW	12	117987453	missense	probably damaging	1.00
R0206:Dnah11	UTSW	12	118043774	missense	probably damaging	0.98
R0206:Dnah11	UTSW	12	118043774	missense	probably damaging	0.98
R0208:Dnah11	UTSW	12	118043774	missense	probably damaging	0.98
R0230:Dnah11	UTSW	12	117983056	nonsense	probably null
R0270:Dnah11	UTSW	12	118041013	missense	probably damaging	1.00
R0311:Dnah11	UTSW	12	118127133	missense	probably benign	0.03
R0325:Dnah11	UTSW	12	118012339	missense	probably benign
R0370:Dnah11	UTSW	12	117995227	missense	probably benign
R0416:Dnah11	UTSW	12	117911058	missense	probably damaging	1.00
R0505:Dnah11	UTSW	12	118106510	missense	probably damaging	1.00
R0540:Dnah11	UTSW	12	118082511	missense	probably damaging	1.00
R0554:Dnah11	UTSW	12	117931178	missense	probably benign	0.01
R0607:Dnah11	UTSW	12	118082511	missense	probably damaging	1.00
R0620:Dnah11	UTSW	12	117987469	missense	probably damaging	1.00
R0635:Dnah11	UTSW	12	118007996	missense	probably damaging	1.00
R0755:Dnah11	UTSW	12	117954829	missense	possibly damaging	0.95
R0755:Dnah11	UTSW	12	118198625	missense	probably benign	0.17
R0789:Dnah11	UTSW	12	117911232	missense	probably damaging	1.00
R0833:Dnah11	UTSW	12	118196662	missense	probably benign	0.01
R0835:Dnah11	UTSW	12	117916788	missense	probably damaging	1.00
R0836:Dnah11	UTSW	12	118196662	missense	probably benign	0.01
R0846:Dnah11	UTSW	12	117933850	missense	probably damaging	0.97
R0865:Dnah11	UTSW	12	118190844	nonsense	probably null
R0928:Dnah11	UTSW	12	118045562	missense	probably damaging	1.00
R0939:Dnah11	UTSW	12	118060407	missense	probably damaging	1.00
R1203:Dnah11	UTSW	12	117933812	missense	possibly damaging	0.81
R1394:Dnah11	UTSW	12	117972364	missense	possibly damaging	0.75
R1398:Dnah11	UTSW	12	118057106	nonsense	probably null
R1465:Dnah11	UTSW	12	118038695	missense	probably damaging	1.00
R1465:Dnah11	UTSW	12	118038695	missense	probably damaging	1.00
R1500:Dnah11	UTSW	12	118012829	splice site	probably null
R1535:Dnah11	UTSW	12	118018730	missense	probably damaging	1.00
R1539:Dnah11	UTSW	12	117931256	missense	probably benign	0.01
R1554:Dnah11	UTSW	12	118082499	missense	possibly damaging	0.92
R1574:Dnah11	UTSW	12	118060317	missense	probably damaging	1.00
R1574:Dnah11	UTSW	12	118060317	missense	probably damaging	1.00
R1615:Dnah11	UTSW	12	118050722	missense	probably damaging	1.00
R1618:Dnah11	UTSW	12	118015465	missense	probably damaging	0.98
R1638:Dnah11	UTSW	12	118015419	missense	possibly damaging	0.81
R1659:Dnah11	UTSW	12	118120724	missense	possibly damaging	0.94
R1671:Dnah11	UTSW	12	117916788	missense	probably damaging	1.00
R1678:Dnah11	UTSW	12	117933845	missense	possibly damaging	0.50
R1699:Dnah11	UTSW	12	118190868	missense	probably damaging	1.00
R1712:Dnah11	UTSW	12	118196644	missense	probably benign	0.32
R1728:Dnah11	UTSW	12	117916931	missense	probably damaging	1.00
R1729:Dnah11	UTSW	12	117916931	missense	probably damaging	1.00
R1764:Dnah11	UTSW	12	118190825	missense	probably benign	0.31
R1780:Dnah11	UTSW	12	118027558	missense	probably damaging	1.00
R1789:Dnah11	UTSW	12	118038780	missense	probably damaging	0.99
R1800:Dnah11	UTSW	12	117916788	missense	probably damaging	1.00
R1863:Dnah11	UTSW	12	118063852	missense	possibly damaging	0.92
R1892:Dnah11	UTSW	12	118106474	missense	possibly damaging	0.53
R1907:Dnah11	UTSW	12	118127556	missense	possibly damaging	0.66
R1964:Dnah11	UTSW	12	118142292	missense	possibly damaging	0.56
R1997:Dnah11	UTSW	12	118082468	missense	possibly damaging	0.64
R2086:Dnah11	UTSW	12	118113871	missense	possibly damaging	0.82
R2092:Dnah11	UTSW	12	118012716	missense	possibly damaging	0.50
R2108:Dnah11	UTSW	12	118020353	missense	probably damaging	1.00
R2140:Dnah11	UTSW	12	118008810	missense	probably benign	0.01
R2261:Dnah11	UTSW	12	117880025	missense	probably benign	0.06
R2261:Dnah11	UTSW	12	117966639	missense	probably damaging	0.99
R2262:Dnah11	UTSW	12	117880025	missense	probably benign	0.06
R2262:Dnah11	UTSW	12	117966639	missense	probably damaging	0.99
R2263:Dnah11	UTSW	12	117880025	missense	probably benign	0.06
R2263:Dnah11	UTSW	12	117966639	missense	probably damaging	0.99
R2328:Dnah11	UTSW	12	117886686	missense	probably damaging	0.98
R2352:Dnah11	UTSW	12	117928330	missense	probably damaging	1.00
R2410:Dnah11	UTSW	12	118027527	missense	probably damaging	1.00
R2885:Dnah11	UTSW	12	117987427	nonsense	probably null
R3499:Dnah11	UTSW	12	117911023	missense	probably damaging	1.00
R3741:Dnah11	UTSW	12	118131341	missense	probably benign	0.05
R3742:Dnah11	UTSW	12	118131341	missense	probably benign	0.05
R3779:Dnah11	UTSW	12	118130713	splice site	probably benign
R3785:Dnah11	UTSW	12	118017602	missense	probably damaging	1.00
R3883:Dnah11	UTSW	12	117978453	splice site	probably benign
R4014:Dnah11	UTSW	12	117974914	missense	probably benign	0.16
R4043:Dnah11	UTSW	12	117879943	missense	probably damaging	1.00
R4072:Dnah11	UTSW	12	118106492	missense	probably damaging	1.00
R4073:Dnah11	UTSW	12	118045678	missense	probably benign	0.01
R4074:Dnah11	UTSW	12	118045678	missense	probably benign	0.01
R4076:Dnah11	UTSW	12	118045678	missense	probably benign	0.01
R4201:Dnah11	UTSW	12	117966659	missense	possibly damaging	0.63
R4224:Dnah11	UTSW	12	118130892	missense	probably benign	0.06
R4233:Dnah11	UTSW	12	117916791	missense	probably damaging	1.00
R4358:Dnah11	UTSW	12	118125843	nonsense	probably null
R4430:Dnah11	UTSW	12	117983011	missense	probably benign	0.26
R4465:Dnah11	UTSW	12	117987451	missense	probably benign	0.09
R4489:Dnah11	UTSW	12	117916896	missense	probably benign	0.31
R4572:Dnah11	UTSW	12	118010125	missense	probably benign	0.00
R4574:Dnah11	UTSW	12	118012255	critical splice donor site	probably null
R4657:Dnah11	UTSW	12	118192427	missense	probably benign	0.02
R4709:Dnah11	UTSW	12	118018760	missense	probably benign	0.26
R4740:Dnah11	UTSW	12	118120544	missense	probably benign	0.28
R4803:Dnah11	UTSW	12	118127608	missense	possibly damaging	0.50
R4896:Dnah11	UTSW	12	117995200	missense	probably damaging	1.00
R4908:Dnah11	UTSW	12	118126883	missense	probably benign	0.37
R5018:Dnah11	UTSW	12	118130728	missense	probably benign	0.00
R5071:Dnah11	UTSW	12	118082453	nonsense	probably null
R5074:Dnah11	UTSW	12	118082453	nonsense	probably null
R5080:Dnah11	UTSW	12	118198830	start codon destroyed	probably null	0.01
R5097:Dnah11	UTSW	12	118017700	missense	probably damaging	1.00
R5131:Dnah11	UTSW	12	117954751	missense	probably damaging	1.00
R5215:Dnah11	UTSW	12	118157361	missense	probably benign	0.09
R5252:Dnah11	UTSW	12	118125941	missense	probably damaging	1.00
R5296:Dnah11	UTSW	12	117883416	missense	probably damaging	1.00
R5308:Dnah11	UTSW	12	118085680	missense	possibly damaging	0.60
R5368:Dnah11	UTSW	12	117954893	missense	probably damaging	1.00
R5383:Dnah11	UTSW	12	118085697	missense	probably damaging	0.99
R5499:Dnah11	UTSW	12	118106474	missense	possibly damaging	0.53
R5503:Dnah11	UTSW	12	117880451	critical splice donor site	probably null
R5546:Dnah11	UTSW	12	117975848	missense	possibly damaging	0.83
R5578:Dnah11	UTSW	12	118018802	missense	probably damaging	0.99
R5657:Dnah11	UTSW	12	117883617	missense	probably damaging	1.00
R5702:Dnah11	UTSW	12	118113907	missense	probably benign	0.04
R5706:Dnah11	UTSW	12	118023935	missense	probably damaging	1.00
R5727:Dnah11	UTSW	12	118127106	missense	probably damaging	1.00
R5737:Dnah11	UTSW	12	118192390	missense	probably benign
R5884:Dnah11	UTSW	12	118177534	missense	probably benign	0.00
R5900:Dnah11	UTSW	12	118082431	splice site	probably null
R5905:Dnah11	UTSW	12	117954924	missense	probably damaging	1.00
R5928:Dnah11	UTSW	12	117914636	splice site	probably null
R5973:Dnah11	UTSW	12	118110952	missense	probably benign	0.02
R6024:Dnah11	UTSW	12	118030272	missense	probably benign	0.34
R6056:Dnah11	UTSW	12	117928456	missense	probably benign	0.03
R6075:Dnah11	UTSW	12	118104851	missense	probably damaging	1.00
R6092:Dnah11	UTSW	12	117928456	missense	probably benign
R6191:Dnah11	UTSW	12	118190897	missense	probably benign
R6197:Dnah11	UTSW	12	118179747	missense	probably benign	0.03
R6262:Dnah11	UTSW	12	117931178	missense	probably damaging	0.98
R6321:Dnah11	UTSW	12	118142292	missense	possibly damaging	0.56
R6454:Dnah11	UTSW	12	117916855	missense	probably benign	0.01
R6614:Dnah11	UTSW	12	117886676	missense	possibly damaging	0.72
R6694:Dnah11	UTSW	12	118186882	splice site	probably null
R6712:Dnah11	UTSW	12	118050722	missense	probably damaging	1.00
R6720:Dnah11	UTSW	12	118045646	missense	probably damaging	1.00
R6742:Dnah11	UTSW	12	118113894	missense	possibly damaging	0.82
R6806:Dnah11	UTSW	12	117987676	splice site	probably null
R6895:Dnah11	UTSW	12	117995191	missense	probably damaging	0.99
R6939:Dnah11	UTSW	12	118106562	missense	probably damaging	1.00
R6940:Dnah11	UTSW	12	118198768	missense	probably benign
R6945:Dnah11	UTSW	12	118060310	missense	probably damaging	1.00
R6958:Dnah11	UTSW	12	117933809	missense	probably damaging	1.00
R6970:Dnah11	UTSW	12	118108944	missense	probably benign	0.00
R6976:Dnah11	UTSW	12	118198643	missense	probably benign	0.16
R7000:Dnah11	UTSW	12	118017661	missense	probably damaging	1.00
R7011:Dnah11	UTSW	12	117922018	frame shift	probably null
R7101:Dnah11	UTSW	12	118068145	missense	probably benign
R7106:Dnah11	UTSW	12	117961149	missense	probably benign	0.15
R7203:Dnah11	UTSW	12	118045522	missense	possibly damaging	0.90
R7219:Dnah11	UTSW	12	118041095	missense	possibly damaging	0.95
R7219:Dnah11	UTSW	12	118126889	missense	probably benign	0.00
R7308:Dnah11	UTSW	12	117995275	missense	probably damaging	1.00
R7361:Dnah11	UTSW	12	118018742	missense	probably damaging	1.00
R7367:Dnah11	UTSW	12	117987442	missense	possibly damaging	0.59
R7399:Dnah11	UTSW	12	118027477	missense	probably benign	0.00
R7399:Dnah11	UTSW	12	118125785	missense	probably damaging	1.00
R7404:Dnah11	UTSW	12	118104808	missense	probably benign	0.36
R7473:Dnah11	UTSW	12	117903176	missense	probably benign	0.19
R7545:Dnah11	UTSW	12	117931204	missense	probably damaging	1.00
R7608:Dnah11	UTSW	12	118140770	splice site	probably null
R7625:Dnah11	UTSW	12	118196642	missense	probably benign
R7761:Dnah11	UTSW	12	118023913	missense	probably damaging	1.00
R7879:Dnah11	UTSW	12	118041009	missense	probably damaging	1.00
R7881:Dnah11	UTSW	12	117987502	missense	probably benign	0.04
R7904:Dnah11	UTSW	12	117903268	missense	possibly damaging	0.72
R8100:Dnah11	UTSW	12	117966633	missense	probably damaging	0.99
R8179:Dnah11	UTSW	12	117878549	missense	possibly damaging	0.90
R8192:Dnah11	UTSW	12	118012446	missense	probably benign
R8254:Dnah11	UTSW	12	117878524	missense	possibly damaging	0.89
R8268:Dnah11	UTSW	12	118027508	nonsense	probably null
R8272:Dnah11	UTSW	12	118111017	missense	probably benign	0.01
R8344:Dnah11	UTSW	12	118085731	missense	probably benign	0.00
R8515:Dnah11	UTSW	12	117975798	missense	probably damaging	1.00
R8528:Dnah11	UTSW	12	118008803	missense	probably damaging	0.96
R8557:Dnah11	UTSW	12	117878512	missense	probably benign
R8676:Dnah11	UTSW	12	118190804	missense	probably damaging	1.00
R8738:Dnah11	UTSW	12	118085649	critical splice donor site	probably null
R8773:Dnah11	UTSW	12	117995215	missense	possibly damaging	0.94
R8818:Dnah11	UTSW	12	117911029	missense	probably damaging	1.00
R8855:Dnah11	UTSW	12	118192372	missense	probably benign	0.03
R8866:Dnah11	UTSW	12	118192372	missense	probably benign	0.03
R8881:Dnah11	UTSW	12	118113912	missense	probably benign	0.00
R8881:Dnah11	UTSW	12	118126815	missense	probably benign	0.05
R8920:Dnah11	UTSW	12	118113939	missense	probably damaging	0.99
R8944:Dnah11	UTSW	12	118127646	missense	possibly damaging	0.63
R8945:Dnah11	UTSW	12	118023983	missense	probably benign	0.36
R8962:Dnah11	UTSW	12	117952538	missense	probably damaging	1.00
R8962:Dnah11	UTSW	12	117954895	missense	probably damaging	1.00
R9059:Dnah11	UTSW	12	118130843	missense	probably benign	0.00
R9155:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9162:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9164:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9171:Dnah11	UTSW	12	117931183	missense	probably damaging	0.99
R9186:Dnah11	UTSW	12	118190897	missense	probably benign
R9205:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9208:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9234:Dnah11	UTSW	12	117987360	missense	probably damaging	1.00
R9264:Dnah11	UTSW	12	118027527	missense	probably damaging	1.00
R9290:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9291:Dnah11	UTSW	12	118027516	missense	probably damaging	0.99
R9315:Dnah11	UTSW	12	118179606	missense	probably benign	0.11
R9353:Dnah11	UTSW	12	118179699	missense	probably benign	0.00
R9375:Dnah11	UTSW	12	117920968	missense	possibly damaging	0.67
R9392:Dnah11	UTSW	12	118047320	nonsense	probably null
R9392:Dnah11	UTSW	12	118177555	missense	probably benign	0.00
R9433:Dnah11	UTSW	12	118012272	missense	probably damaging	1.00
R9511:Dnah11	UTSW	12	117914617	missense	probably damaging	1.00
R9526:Dnah11	UTSW	12	118186976	missense	probably damaging	0.98
R9566:Dnah11	UTSW	12	117974993	missense	possibly damaging	0.69
R9673:Dnah11	UTSW	12	118018778	missense	possibly damaging	0.91
R9705:Dnah11	UTSW	12	118131035	missense	probably damaging	1.00
R9716:Dnah11	UTSW	12	118060413	missense	probably damaging	0.99
R9746:Dnah11	UTSW	12	117878576	nonsense	probably null
R9764:Dnah11	UTSW	12	117920969	missense	probably benign	0.05
RF023:Dnah11	UTSW	12	117954850	missense	probably damaging	1.00
RF047:Dnah11	UTSW	12	118010083	missense	probably damaging	1.00
Z1088:Dnah11	UTSW	12	117895012	missense	probably damaging	1.00
Z1088:Dnah11	UTSW	12	117982969	missense	probably damaging	1.00
Z1176:Dnah11	UTSW	12	117931177	missense	possibly damaging	0.81
Z1176:Dnah11	UTSW	12	118127119	missense	probably benign	0.00
Z1176:Dnah11	UTSW	12	118130799	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TGCGGAGTCTGCATATAAACC -3'
(R):5'- TGACATCCCCTGCAAAAGAG -3'

Sequencing Primer
(F):5'- GGAGTCTGCATATAAACCAGCTC -3'
(R):5'- TCATGCCGTATTGCAGGCAG -3'

Posted On

2014-08-25