Incidental Mutation 'R0135:Dgcr2'
ID21910
Institutional Source Beutler Lab
Gene Symbol Dgcr2
Ensembl Gene ENSMUSG00000003166
Gene NameDiGeorge syndrome critical region gene 2
Synonyms9930034O06Rik, Dgsc, Dgcr2, DGS-C, Lan, Sez12, Idd
MMRRC Submission 038420-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0135 (G1)
Quality Score225
Status Validated (trace)
Chromosome16
Chromosomal Location17839482-17898562 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 17858442 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 152 (S152P)
Ref Sequence ENSEMBL: ENSMUSP00000112783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012152] [ENSMUST00000066127] [ENSMUST00000117082] [ENSMUST00000117945] [ENSMUST00000150068] [ENSMUST00000155943]
Predicted Effect probably damaging
Transcript: ENSMUST00000012152
AA Change: S155P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000012152
Gene: ENSMUSG00000003166
AA Change: S155P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 6.28e-11 SMART
CLECT 114 265 1.06e-14 SMART
VWC 270 331 1.42e-9 SMART
transmembrane domain 345 367 N/A INTRINSIC
low complexity region 369 377 N/A INTRINSIC
low complexity region 438 449 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000066127
AA Change: S152P

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000064603
Gene: ENSMUSG00000003166
AA Change: S152P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 6.28e-11 SMART
CLECT 111 262 1.06e-14 SMART
transmembrane domain 274 296 N/A INTRINSIC
low complexity region 298 306 N/A INTRINSIC
low complexity region 367 378 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117082
AA Change: S154P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113506
Gene: ENSMUSG00000003166
AA Change: S154P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 5.86e-11 SMART
CLECT 113 264 1.06e-14 SMART
VWC 269 330 1.42e-9 SMART
transmembrane domain 344 366 N/A INTRINSIC
low complexity region 368 376 N/A INTRINSIC
low complexity region 437 448 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117945
AA Change: S152P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112783
Gene: ENSMUSG00000003166
AA Change: S152P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 6.28e-11 SMART
CLECT 111 262 1.06e-14 SMART
VWC 267 328 1.42e-9 SMART
transmembrane domain 342 364 N/A INTRINSIC
low complexity region 366 374 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135229
Predicted Effect possibly damaging
Transcript: ENSMUST00000150068
AA Change: S155P

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115071
Gene: ENSMUSG00000092470
AA Change: S155P

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 6.28e-11 SMART
CLECT 114 265 1.06e-14 SMART
VWC 270 331 1.42e-9 SMART
transmembrane domain 345 367 N/A INTRINSIC
low complexity region 369 377 N/A INTRINSIC
low complexity region 438 449 N/A INTRINSIC
low complexity region 559 565 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155611
Predicted Effect probably benign
Transcript: ENSMUST00000155943
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231750
Meta Mutation Damage Score 0.17 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Deletions of the 22q11.2 have been associated with a wide range of developmental defects (notably DiGeorge syndrome, velocardiofacial syndrome, conotruncal anomaly face syndrome and isolated conotruncal cardiac defects) classified under the acronym CATCH 22. The DGCR2 gene encodes a novel putative adhesion receptor protein, which could play a role in neural crest cells migration, a process which has been proposed to be altered in DiGeorge syndrome. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T C 7: 34,245,957 I499M probably damaging Het
4932438H23Rik A G 16: 91,055,627 F207S probably damaging Het
Abhd8 T A 8: 71,458,074 K363N probably benign Het
Adam11 T A 11: 102,776,573 V653E probably damaging Het
Adam18 T C 8: 24,665,542 S154G possibly damaging Het
Adamts1 T C 16: 85,798,703 probably benign Het
Afm G T 5: 90,550,322 V528L probably benign Het
Alox12b C T 11: 69,162,748 H145Y probably benign Het
Ankmy2 C A 12: 36,170,435 probably benign Het
Aox3 G A 1: 58,125,088 probably benign Het
Arhgap28 T C 17: 67,864,588 D396G probably damaging Het
B430203G13Rik T C 12: 17,924,488 noncoding transcript Het
Bean1 C T 8: 104,217,175 P121S probably damaging Het
Bok T C 1: 93,686,507 S21P probably damaging Het
Brwd1 A C 16: 96,047,104 N572K probably damaging Het
C5ar1 A T 7: 16,248,939 V52E probably damaging Het
Cdr2l C A 11: 115,393,671 P278T probably damaging Het
Cnga4 T A 7: 105,406,848 I219N probably damaging Het
Cpne2 C T 8: 94,554,925 probably benign Het
D430041D05Rik A G 2: 104,255,034 S1057P possibly damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dstyk A T 1: 132,462,934 D828V probably damaging Het
Eml2 T C 7: 19,203,952 S582P probably damaging Het
Engase T C 11: 118,484,478 Y359H possibly damaging Het
Fat3 T C 9: 16,006,777 D1450G probably damaging Het
Fbxw8 A T 5: 118,070,487 I467N probably damaging Het
Fhdc1 A T 3: 84,445,618 Y767N probably damaging Het
Flii T C 11: 60,723,378 D105G probably damaging Het
Gaa C T 11: 119,278,890 T590I probably benign Het
Gabrr1 T A 4: 33,160,224 S303T probably damaging Het
Gif G T 19: 11,757,754 C246F probably damaging Het
Glp1r A G 17: 30,924,577 I196V probably benign Het
Gm884 C A 11: 103,618,047 probably benign Het
Grm6 G A 11: 50,853,223 E174K probably damaging Het
Helz2 A C 2: 181,232,269 L2144R probably damaging Het
Itpr1 A T 6: 108,488,482 probably benign Het
Kcns1 A T 2: 164,164,955 S363T possibly damaging Het
Kif13a A T 13: 46,793,943 V855E probably damaging Het
Krt42 T C 11: 100,263,159 T424A possibly damaging Het
Lct A T 1: 128,285,123 F1931Y probably damaging Het
Lrp1b A T 2: 41,269,239 V1563E probably damaging Het
Lzts2 T C 19: 45,026,187 probably benign Het
Mamdc4 C T 2: 25,566,920 R615Q possibly damaging Het
Mei1 C T 15: 82,071,969 Q133* probably null Het
Mif4gd T C 11: 115,608,465 E197G probably damaging Het
Ncdn A T 4: 126,746,669 S544T probably benign Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Olfr68 T A 7: 103,777,763 D194V probably damaging Het
Padi6 T C 4: 140,737,352 T114A probably benign Het
Pigk G T 3: 152,744,706 probably benign Het
Pkd1 T A 17: 24,565,071 F197Y possibly damaging Het
Pld5 A T 1: 175,970,589 F415I probably damaging Het
Pnpla5 A G 15: 84,113,949 L364P probably damaging Het
Prrc2c G A 1: 162,715,483 probably benign Het
Rab32 C T 10: 10,550,840 D121N probably damaging Het
Rab44 A T 17: 29,138,132 T79S probably benign Het
Reln G T 5: 22,128,649 N258K probably damaging Het
Retsat A G 6: 72,602,772 T177A probably damaging Het
Serpinf2 T A 11: 75,436,393 H236L probably damaging Het
Slc26a6 A T 9: 108,860,595 probably benign Het
Slitrk1 T A 14: 108,911,629 E550V probably benign Het
Smarcd3 A T 5: 24,595,499 probably benign Het
Spdye4a A C 5: 143,225,102 probably null Het
Susd2 C T 10: 75,638,514 G572D probably damaging Het
Tcaf3 C T 6: 42,589,758 R799K probably benign Het
Tg A G 15: 66,694,870 S1256G probably benign Het
Them4 A T 3: 94,323,570 probably benign Het
Tmem210 C T 2: 25,288,468 A47V probably damaging Het
Tnfrsf1b A G 4: 145,229,046 Y47H probably benign Het
Tnik T G 3: 28,607,245 N598K possibly damaging Het
Ttc3 A G 16: 94,462,268 N1498D possibly damaging Het
Ttll4 C A 1: 74,679,928 H313N possibly damaging Het
Vipr2 A G 12: 116,142,827 I348V probably benign Het
Vps13a A G 19: 16,780,765 V2A probably damaging Het
Vps72 G A 3: 95,119,197 R151K probably damaging Het
Zfp106 A G 2: 120,520,487 V1561A probably damaging Het
Zfp658 C A 7: 43,573,595 Y431* probably null Het
Zkscan2 T C 7: 123,480,641 K698E possibly damaging Het
Other mutations in Dgcr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0218:Dgcr2 UTSW 16 17849786 missense probably damaging 1.00
R0627:Dgcr2 UTSW 16 17844008 missense probably damaging 1.00
R1450:Dgcr2 UTSW 16 17856814 missense possibly damaging 0.71
R1769:Dgcr2 UTSW 16 17857251 splice site probably benign
R1836:Dgcr2 UTSW 16 17849720 missense probably damaging 1.00
R2152:Dgcr2 UTSW 16 17891487 unclassified probably null
R2259:Dgcr2 UTSW 16 17844977 splice site probably null
R4815:Dgcr2 UTSW 16 17858619 intron probably benign
R4829:Dgcr2 UTSW 16 17842753 missense possibly damaging 0.90
R5372:Dgcr2 UTSW 16 17872644 missense probably benign 0.00
R5931:Dgcr2 UTSW 16 17857309 missense possibly damaging 0.71
R7008:Dgcr2 UTSW 16 17845001 missense probably damaging 1.00
R7285:Dgcr2 UTSW 16 17845080 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCCTCAAGTGTGGTCTGCCAGTG -3'
(R):5'- GTCAACATGCCTCTGATGTGGTCC -3'

Sequencing Primer
(F):5'- GGTCTGCCAGTGAGTGC -3'
(R):5'- caaccatctgtaacttctaactcc -3'
Posted On2013-04-12