Incidental Mutation 'R1967:Atp13a4'
ID 219113
Institutional Source Beutler Lab
Gene Symbol Atp13a4
Ensembl Gene ENSMUSG00000038094
Gene Name ATPase type 13A4
Synonyms 4631413J11Rik, 9330174J19Rik
MMRRC Submission 039980-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1967 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 29214671-29363682 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 29298672 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 96 (S96P)
Ref Sequence ENSEMBL: ENSMUSP00000048753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039090] [ENSMUST00000057018] [ENSMUST00000182013] [ENSMUST00000182627]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000039090
AA Change: S96P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000048753
Gene: ENSMUSG00000038094
AA Change: S96P

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 8.4e-31 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 1.7e-36 PFAM
Pfam:Hydrolase 481 769 3.9e-11 PFAM
Pfam:HAD 484 787 4.1e-14 PFAM
Pfam:Hydrolase_like2 574 637 1.2e-9 PFAM
transmembrane domain 824 846 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057018
AA Change: S96P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000060987
Gene: ENSMUSG00000038094
AA Change: S96P

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 142 9.6e-34 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 228 476 1.6e-34 PFAM
Pfam:Hydrolase 481 767 1.1e-10 PFAM
Pfam:HAD 484 858 3.3e-23 PFAM
Pfam:Cation_ATPase 573 637 4.9e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182013
SMART Domains Protein: ENSMUSP00000138583
Gene: ENSMUSG00000038094

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 84 4.2e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000182627
AA Change: S96P

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138479
Gene: ENSMUSG00000038094
AA Change: S96P

DomainStartEndE-ValueType
Pfam:P5-ATPase 17 143 2.1e-29 PFAM
Cation_ATPase_N 147 223 1.09e-1 SMART
Pfam:E1-E2_ATPase 229 476 3.9e-35 PFAM
Pfam:Hydrolase 481 861 4.2e-16 PFAM
Pfam:HAD 484 858 1.9e-23 PFAM
Pfam:Hydrolase_like2 574 637 2.2e-8 PFAM
transmembrane domain 902 924 N/A INTRINSIC
transmembrane domain 934 951 N/A INTRINSIC
transmembrane domain 972 994 N/A INTRINSIC
low complexity region 1014 1023 N/A INTRINSIC
transmembrane domain 1040 1057 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1126 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930447A16Rik A C 15: 37,439,842 (GRCm39) probably benign Het
Abca6 T C 11: 110,077,974 (GRCm39) I1278V probably benign Het
Adamts15 C T 9: 30,832,605 (GRCm39) W310* probably null Het
Adamts6 T A 13: 104,563,459 (GRCm39) C650* probably null Het
Akap3 G T 6: 126,842,061 (GRCm39) G227C probably benign Het
Alox12e A T 11: 70,208,682 (GRCm39) S457T probably benign Het
Angpt1 C A 15: 42,301,703 (GRCm39) C435F probably damaging Het
Anxa9 T C 3: 95,207,919 (GRCm39) Q207R probably benign Het
Aplnr A T 2: 84,967,950 (GRCm39) D325V probably benign Het
Art2b A C 7: 101,229,414 (GRCm39) F162V probably damaging Het
Bnc1 A T 7: 81,623,384 (GRCm39) H614Q probably benign Het
C6 A G 15: 4,789,302 (GRCm39) D249G probably damaging Het
Camta1 A T 4: 151,173,430 (GRCm39) F977I probably damaging Het
Chil6 T C 3: 106,298,470 (GRCm39) S188G possibly damaging Het
Cntrob A T 11: 69,211,789 (GRCm39) L145Q probably damaging Het
Coro7 T C 16: 4,452,753 (GRCm39) E306G probably damaging Het
Cplane1 T G 15: 8,232,904 (GRCm39) V1141G probably benign Het
Cpq T C 15: 33,497,348 (GRCm39) S363P possibly damaging Het
Ctc1 A G 11: 68,918,688 (GRCm39) probably null Het
Defb43 T A 14: 63,255,246 (GRCm39) N26K probably benign Het
Dennd1a T C 2: 37,734,845 (GRCm39) T41A probably benign Het
Dnah11 A C 12: 117,880,523 (GRCm39) Y3866D probably damaging Het
Eml6 A G 11: 29,974,545 (GRCm39) L11P probably damaging Het
Epha5 A G 5: 84,564,288 (GRCm39) V26A probably benign Het
Fam13c A G 10: 70,387,565 (GRCm39) D443G probably damaging Het
Fam227a G A 15: 79,521,335 (GRCm39) L243F possibly damaging Het
Fat3 T G 9: 15,879,591 (GRCm39) R3301S probably benign Het
Fbxw20 T C 9: 109,046,578 (GRCm39) T461A probably benign Het
Fgf8 T A 19: 45,730,007 (GRCm39) S61C probably damaging Het
Fgfrl1 A G 5: 108,852,871 (GRCm39) E100G probably damaging Het
Gabra4 G A 5: 71,729,412 (GRCm39) S456F possibly damaging Het
Gas6 T C 8: 13,520,317 (GRCm39) E457G probably damaging Het
Gpr33 G A 12: 52,070,991 (GRCm39) S16L probably benign Het
Greb1l A C 18: 10,501,049 (GRCm39) N393T possibly damaging Het
Gtpbp4 T C 13: 9,027,340 (GRCm39) K492E probably benign Het
Hsf2bp A T 17: 32,206,378 (GRCm39) L251* probably null Het
Hyal5 A T 6: 24,876,193 (GRCm39) Q22L possibly damaging Het
Itih1 A T 14: 30,663,941 (GRCm39) V114E possibly damaging Het
Jak3 T A 8: 72,134,179 (GRCm39) I427N probably damaging Het
Jcad T C 18: 4,675,162 (GRCm39) S975P probably benign Het
Kcng4 A G 8: 120,359,662 (GRCm39) V238A probably damaging Het
Klb A G 5: 65,529,417 (GRCm39) D315G probably damaging Het
Klrh1 A T 6: 129,752,798 (GRCm39) N2K possibly damaging Het
Krt5 T C 15: 101,620,094 (GRCm39) N208D probably benign Het
Lmo7 T A 14: 102,137,651 (GRCm39) H551Q probably benign Het
Lrp8 G T 4: 107,717,168 (GRCm39) G732V probably damaging Het
Lrrc38 A G 4: 143,096,553 (GRCm39) D288G unknown Het
Lrrc4b GAGAAG GAG 7: 44,111,654 (GRCm39) probably benign Het
Mas1 A G 17: 13,060,923 (GRCm39) Y167H probably benign Het
Mcm8 A C 2: 132,684,662 (GRCm39) I759L probably benign Het
Med13l G A 5: 118,899,387 (GRCm39) D2148N probably damaging Het
Muc20 A T 16: 32,614,612 (GRCm39) I255K probably benign Het
Myh1 A G 11: 67,104,273 (GRCm39) N980S probably benign Het
Nap1l4 T A 7: 143,088,024 (GRCm39) Q178L probably damaging Het
Ncapg T A 5: 45,857,252 (GRCm39) L988Q probably damaging Het
Ncf2 A T 1: 152,706,123 (GRCm39) H245L probably damaging Het
Neurl4 A G 11: 69,794,036 (GRCm39) E164G possibly damaging Het
Nf1 G A 11: 79,303,571 (GRCm39) R416H probably damaging Het
Obscn G A 11: 59,026,535 (GRCm39) Q223* probably null Het
Or10q1 T A 19: 13,727,417 (GRCm39) *316R probably null Het
Or2o1 T C 11: 49,051,675 (GRCm39) I278T probably benign Het
Pcdhb16 T A 18: 37,612,715 (GRCm39) N558K probably damaging Het
Pcnx2 A T 8: 126,542,422 (GRCm39) M1253K possibly damaging Het
Pla2g4a A G 1: 149,797,832 (GRCm39) V22A probably damaging Het
Plppr5 G A 3: 117,419,555 (GRCm39) probably null Het
Pnpla2 T C 7: 141,039,345 (GRCm39) S353P probably benign Het
Pom121 A T 5: 135,420,608 (GRCm39) L271Q unknown Het
Prepl A T 17: 85,395,979 (GRCm39) M1K probably null Het
Prr14l A G 5: 33,001,813 (GRCm39) probably benign Het
Psmc3 C A 2: 90,888,189 (GRCm39) P325T probably benign Het
Psme2b A G 11: 48,836,896 (GRCm39) V17A probably damaging Het
Ptpro A G 6: 137,393,863 (GRCm39) I23V probably benign Het
Rab31 A G 17: 66,079,499 (GRCm39) probably null Het
Ranbp6 T A 19: 29,789,900 (GRCm39) K151* probably null Het
Rbm12b1 A T 4: 12,146,304 (GRCm39) I759L probably benign Het
Rgs5 T C 1: 169,504,425 (GRCm39) I25T probably benign Het
Rnf213 T C 11: 119,371,721 (GRCm39) V4842A probably damaging Het
Rtl9 A T X: 141,886,037 (GRCm39) I1150F probably damaging Het
Scn1a A T 2: 66,158,769 (GRCm39) W384R probably damaging Het
Sema5a C T 15: 32,681,765 (GRCm39) P948L probably damaging Het
Slc26a3 G A 12: 31,515,777 (GRCm39) R559Q probably damaging Het
Slc29a3 A G 10: 60,552,243 (GRCm39) V267A probably benign Het
Spata22 A G 11: 73,221,953 (GRCm39) probably benign Het
Spata31e2 T A 1: 26,722,454 (GRCm39) I909L probably benign Het
Sptbn2 G T 19: 4,795,327 (GRCm39) R1595L probably benign Het
Tfdp1 T C 8: 13,423,039 (GRCm39) S315P possibly damaging Het
Tle1 A T 4: 72,038,463 (GRCm39) V688E probably damaging Het
Tmem129 A T 5: 33,812,665 (GRCm39) probably null Het
Tmprss11a G A 5: 86,579,702 (GRCm39) T91I probably benign Het
Tnfsf14 A G 17: 57,497,807 (GRCm39) Y142H probably damaging Het
Tph1 T C 7: 46,311,538 (GRCm39) D68G probably benign Het
Ttn A T 2: 76,592,631 (GRCm39) S12507T probably damaging Het
Tubgcp2 T A 7: 139,586,066 (GRCm39) M408L probably benign Het
Usp34 A T 11: 23,314,503 (GRCm39) H815L probably benign Het
Usp6nl G A 2: 6,446,330 (GRCm39) R746H probably benign Het
Utp20 A G 10: 88,652,841 (GRCm39) S358P probably benign Het
Vmn2r118 G A 17: 55,899,882 (GRCm39) T674I probably damaging Het
Vmn2r8 A T 5: 108,950,249 (GRCm39) H199Q probably benign Het
Vmn2r9 A G 5: 108,995,388 (GRCm39) V420A probably benign Het
Vmn2r99 A T 17: 19,599,077 (GRCm39) T254S probably benign Het
Zbed5 A G 5: 129,930,510 (GRCm39) H132R possibly damaging Het
Zfp568 A G 7: 29,688,513 (GRCm39) E25G probably damaging Het
Zfp951 T A 5: 104,964,866 (GRCm39) I67L possibly damaging Het
Other mutations in Atp13a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00563:Atp13a4 APN 16 29,222,596 (GRCm39) splice site probably benign
IGL01577:Atp13a4 APN 16 29,260,102 (GRCm39) missense possibly damaging 0.77
IGL01834:Atp13a4 APN 16 29,234,595 (GRCm39) splice site probably benign
IGL02165:Atp13a4 APN 16 29,252,828 (GRCm39) missense probably damaging 1.00
IGL02194:Atp13a4 APN 16 29,275,447 (GRCm39) missense probably damaging 1.00
IGL02322:Atp13a4 APN 16 29,258,920 (GRCm39) missense probably benign 0.00
IGL02553:Atp13a4 APN 16 29,241,521 (GRCm39) missense probably benign 0.03
IGL02821:Atp13a4 APN 16 29,260,125 (GRCm39) missense probably benign 0.01
IGL03349:Atp13a4 APN 16 29,275,489 (GRCm39) missense probably benign 0.01
G5030:Atp13a4 UTSW 16 29,274,306 (GRCm39) missense probably damaging 1.00
R0091:Atp13a4 UTSW 16 29,274,213 (GRCm39) missense probably damaging 1.00
R0100:Atp13a4 UTSW 16 29,240,542 (GRCm39) missense probably damaging 1.00
R0278:Atp13a4 UTSW 16 29,273,652 (GRCm39) missense probably damaging 1.00
R1263:Atp13a4 UTSW 16 29,290,771 (GRCm39) missense possibly damaging 0.60
R1378:Atp13a4 UTSW 16 29,239,246 (GRCm39) missense probably damaging 1.00
R1575:Atp13a4 UTSW 16 29,228,528 (GRCm39) missense probably benign 0.01
R1720:Atp13a4 UTSW 16 29,227,746 (GRCm39) missense probably damaging 0.99
R1759:Atp13a4 UTSW 16 29,275,429 (GRCm39) missense probably damaging 0.99
R2030:Atp13a4 UTSW 16 29,241,502 (GRCm39) missense probably damaging 1.00
R2113:Atp13a4 UTSW 16 29,260,102 (GRCm39) missense possibly damaging 0.77
R3409:Atp13a4 UTSW 16 29,232,567 (GRCm39) missense probably damaging 1.00
R3410:Atp13a4 UTSW 16 29,232,567 (GRCm39) missense probably damaging 1.00
R4032:Atp13a4 UTSW 16 29,237,389 (GRCm39) missense probably damaging 1.00
R4163:Atp13a4 UTSW 16 29,360,068 (GRCm39) missense possibly damaging 0.87
R4652:Atp13a4 UTSW 16 29,271,421 (GRCm39) missense probably damaging 1.00
R4772:Atp13a4 UTSW 16 29,239,653 (GRCm39) intron probably benign
R4795:Atp13a4 UTSW 16 29,308,826 (GRCm39) critical splice donor site probably null
R4898:Atp13a4 UTSW 16 29,227,779 (GRCm39) nonsense probably null
R4996:Atp13a4 UTSW 16 29,290,822 (GRCm39) missense probably damaging 1.00
R5112:Atp13a4 UTSW 16 29,228,686 (GRCm39) missense possibly damaging 0.87
R5259:Atp13a4 UTSW 16 29,275,428 (GRCm39) missense probably damaging 1.00
R5395:Atp13a4 UTSW 16 29,275,422 (GRCm39) missense possibly damaging 0.94
R5395:Atp13a4 UTSW 16 29,239,706 (GRCm39) nonsense probably null
R5640:Atp13a4 UTSW 16 29,234,649 (GRCm39) missense probably damaging 0.98
R5809:Atp13a4 UTSW 16 29,252,805 (GRCm39) missense possibly damaging 0.56
R5856:Atp13a4 UTSW 16 29,252,805 (GRCm39) missense possibly damaging 0.94
R5912:Atp13a4 UTSW 16 29,275,389 (GRCm39) missense probably benign 0.33
R6282:Atp13a4 UTSW 16 29,252,822 (GRCm39) missense probably benign 0.00
R6404:Atp13a4 UTSW 16 29,290,719 (GRCm39) nonsense probably null
R6497:Atp13a4 UTSW 16 29,298,719 (GRCm39) missense probably damaging 1.00
R6577:Atp13a4 UTSW 16 29,298,659 (GRCm39) missense probably benign 0.03
R6806:Atp13a4 UTSW 16 29,288,098 (GRCm39) missense probably damaging 1.00
R7229:Atp13a4 UTSW 16 29,239,723 (GRCm39) missense probably benign 0.05
R7438:Atp13a4 UTSW 16 29,260,014 (GRCm39) missense
R7493:Atp13a4 UTSW 16 29,290,774 (GRCm39) missense
R7712:Atp13a4 UTSW 16 29,278,305 (GRCm39) missense
R7739:Atp13a4 UTSW 16 29,275,419 (GRCm39) missense
R7897:Atp13a4 UTSW 16 29,215,284 (GRCm39) missense
R7950:Atp13a4 UTSW 16 29,268,735 (GRCm39) missense
R8217:Atp13a4 UTSW 16 29,222,619 (GRCm39) missense
R8227:Atp13a4 UTSW 16 29,222,663 (GRCm39) missense
R8273:Atp13a4 UTSW 16 29,290,720 (GRCm39) missense
R8488:Atp13a4 UTSW 16 29,236,654 (GRCm39) missense possibly damaging 0.63
R8508:Atp13a4 UTSW 16 29,273,587 (GRCm39) nonsense probably null
R8773:Atp13a4 UTSW 16 29,260,398 (GRCm39) missense
R8921:Atp13a4 UTSW 16 29,273,592 (GRCm39) missense
R8940:Atp13a4 UTSW 16 29,273,508 (GRCm39) critical splice donor site probably null
R9056:Atp13a4 UTSW 16 29,290,706 (GRCm39) critical splice donor site probably null
R9272:Atp13a4 UTSW 16 29,268,797 (GRCm39) missense
R9292:Atp13a4 UTSW 16 29,241,500 (GRCm39) missense
R9415:Atp13a4 UTSW 16 29,227,821 (GRCm39) missense
R9453:Atp13a4 UTSW 16 29,239,659 (GRCm39) missense unknown
R9497:Atp13a4 UTSW 16 29,288,130 (GRCm39) critical splice acceptor site probably null
R9541:Atp13a4 UTSW 16 29,241,544 (GRCm39) missense
R9614:Atp13a4 UTSW 16 29,260,398 (GRCm39) missense
R9622:Atp13a4 UTSW 16 29,239,277 (GRCm39) missense
R9727:Atp13a4 UTSW 16 29,228,589 (GRCm39) missense
Z1176:Atp13a4 UTSW 16 29,241,405 (GRCm39) missense probably null
Predicted Primers PCR Primer
(F):5'- ACATCACTGCAAGACTGGC -3'
(R):5'- GATCCTATGCCACCTTTCAATG -3'

Sequencing Primer
(F):5'- TCTATGGGCACACATATGGC -3'
(R):5'- AGCCTAATGACCTTCTCTT -3'
Posted On 2014-08-25