Incidental Mutation 'R1967:Greb1l'
ID219123
Institutional Source Beutler Lab
Gene Symbol Greb1l
Ensembl Gene ENSMUSG00000042942
Gene Namegrowth regulation by estrogen in breast cancer-like
SynonymsAK220484, mKIAA4095
MMRRC Submission 039980-MU
Accession Numbers

Genbank: NM_001083628; MGI: 3576497

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1967 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location10325177-10562934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 10501049 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Threonine at position 393 (N393T)
Ref Sequence ENSEMBL: ENSMUSP00000134090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048977] [ENSMUST00000172532]
Predicted Effect probably benign
Transcript: ENSMUST00000048977
AA Change: N393T

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000049003
Gene: ENSMUSG00000042942
AA Change: N393T

DomainStartEndE-ValueType
Pfam:GREB1 1 1172 N/A PFAM
Pfam:GREB1 1154 1913 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172532
AA Change: N393T

PolyPhen 2 Score 0.908 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134090
Gene: ENSMUSG00000042942
AA Change: N393T

DomainStartEndE-ValueType
low complexity region 83 100 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
low complexity region 606 617 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224958
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T G 15: 8,203,420 V1141G probably benign Het
4930447A16Rik A C 15: 37,439,598 probably benign Het
4931408C20Rik T A 1: 26,683,373 I909L probably benign Het
Abca6 T C 11: 110,187,148 I1278V probably benign Het
Adamts15 C T 9: 30,921,309 W310* probably null Het
Adamts6 T A 13: 104,426,951 C650* probably null Het
Akap3 G T 6: 126,865,098 G227C probably benign Het
Alox12e A T 11: 70,317,856 S457T probably benign Het
Angpt1 C A 15: 42,438,307 C435F probably damaging Het
Anxa9 T C 3: 95,300,608 Q207R probably benign Het
Aplnr A T 2: 85,137,606 D325V probably benign Het
Art2b A C 7: 101,580,207 F162V probably damaging Het
Atp13a4 A G 16: 29,479,854 S96P probably damaging Het
Bnc1 A T 7: 81,973,636 H614Q probably benign Het
C6 A G 15: 4,759,820 D249G probably damaging Het
Camta1 A T 4: 151,088,973 F977I probably damaging Het
Chil6 T C 3: 106,391,154 S188G possibly damaging Het
Cntrob A T 11: 69,320,963 L145Q probably damaging Het
Coro7 T C 16: 4,634,889 E306G probably damaging Het
Cpq T C 15: 33,497,202 S363P possibly damaging Het
Ctc1 A G 11: 69,027,862 probably null Het
Defb43 T A 14: 63,017,797 N26K probably benign Het
Dennd1a T C 2: 37,844,833 T41A probably benign Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Eml6 A G 11: 30,024,545 L11P probably damaging Het
Epha5 A G 5: 84,416,429 V26A probably benign Het
Fam13c A G 10: 70,551,735 D443G probably damaging Het
Fam227a G A 15: 79,637,134 L243F possibly damaging Het
Fat3 T G 9: 15,968,295 R3301S probably benign Het
Fbxw20 T C 9: 109,217,510 T461A probably benign Het
Fgf8 T A 19: 45,741,568 S61C probably damaging Het
Fgfrl1 A G 5: 108,705,005 E100G probably damaging Het
Gabra4 G A 5: 71,572,069 S456F possibly damaging Het
Gas6 T C 8: 13,470,317 E457G probably damaging Het
Gm156 A T 6: 129,775,835 N2K possibly damaging Het
Gpr33 G A 12: 52,024,208 S16L probably benign Het
Gtpbp4 T C 13: 8,977,304 K492E probably benign Het
Hsf2bp A T 17: 31,987,404 L251* probably null Het
Hyal5 A T 6: 24,876,194 Q22L possibly damaging Het
Itih1 A T 14: 30,941,984 V114E possibly damaging Het
Jak3 T A 8: 71,681,535 I427N probably damaging Het
Jcad T C 18: 4,675,162 S975P probably benign Het
Kcng4 A G 8: 119,632,923 V238A probably damaging Het
Klb A G 5: 65,372,074 D315G probably damaging Het
Krt5 T C 15: 101,711,659 N208D probably benign Het
Lmo7 T A 14: 101,900,215 H551Q probably benign Het
Lrp8 G T 4: 107,859,971 G732V probably damaging Het
Lrrc38 A G 4: 143,369,983 D288G unknown Het
Lrrc4b GAGAAG GAG 7: 44,462,230 probably benign Het
Mas1 A G 17: 12,842,036 Y167H probably benign Het
Mcm8 A C 2: 132,842,742 I759L probably benign Het
Med13l G A 5: 118,761,322 D2148N probably damaging Het
Muc20 A T 16: 32,794,242 I255K probably benign Het
Myh1 A G 11: 67,213,447 N980S probably benign Het
Nap1l4 T A 7: 143,534,287 Q178L probably damaging Het
Ncapg T A 5: 45,699,910 L988Q probably damaging Het
Ncf2 A T 1: 152,830,372 H245L probably damaging Het
Neurl4 A G 11: 69,903,210 E164G possibly damaging Het
Nf1 G A 11: 79,412,745 R416H probably damaging Het
Obscn G A 11: 59,135,709 Q223* probably null Het
Olfr1394 T C 11: 49,160,848 I278T probably benign Het
Olfr1494 T A 19: 13,750,053 *316R probably null Het
Pcdhb16 T A 18: 37,479,662 N558K probably damaging Het
Pcnx2 A T 8: 125,815,683 M1253K possibly damaging Het
Pla2g4a A G 1: 149,922,081 V22A probably damaging Het
Plppr5 G A 3: 117,625,906 probably null Het
Pnpla2 T C 7: 141,459,432 S353P probably benign Het
Pom121 A T 5: 135,391,754 L271Q unknown Het
Prepl A T 17: 85,088,551 M1K probably null Het
Prr14l A G 5: 32,844,469 probably benign Het
Psmc3 C A 2: 91,057,844 P325T probably benign Het
Psme2b A G 11: 48,946,069 V17A probably damaging Het
Ptpro A G 6: 137,416,865 I23V probably benign Het
Rab31 A G 17: 65,772,504 probably null Het
Ranbp6 T A 19: 29,812,500 K151* probably null Het
Rbm12b1 A T 4: 12,146,304 I759L probably benign Het
Rgs5 T C 1: 169,676,856 I25T probably benign Het
Rnf213 T C 11: 119,480,895 V4842A probably damaging Het
Rtl9 A T X: 143,103,041 I1150F probably damaging Het
Scn1a A T 2: 66,328,425 W384R probably damaging Het
Sema5a C T 15: 32,681,619 P948L probably damaging Het
Slc26a3 G A 12: 31,465,778 R559Q probably damaging Het
Slc29a3 A G 10: 60,716,464 V267A probably benign Het
Spata22 A G 11: 73,331,127 probably benign Het
Sptbn2 G T 19: 4,745,299 R1595L probably benign Het
Tfdp1 T C 8: 13,373,039 S315P possibly damaging Het
Tle1 A T 4: 72,120,226 V688E probably damaging Het
Tmem129 A T 5: 33,655,321 probably null Het
Tmprss11a G A 5: 86,431,843 T91I probably benign Het
Tnfsf14 A G 17: 57,190,807 Y142H probably damaging Het
Tph1 T C 7: 46,662,114 D68G probably benign Het
Ttn A T 2: 76,762,287 S12507T probably damaging Het
Tubgcp2 T A 7: 140,006,153 M408L probably benign Het
Usp34 A T 11: 23,364,503 H815L probably benign Het
Usp6nl G A 2: 6,441,519 R746H probably benign Het
Utp20 A G 10: 88,816,979 S358P probably benign Het
Vmn2r118 G A 17: 55,592,882 T674I probably damaging Het
Vmn2r8 A T 5: 108,802,383 H199Q probably benign Het
Vmn2r9 A G 5: 108,847,522 V420A probably benign Het
Vmn2r99 A T 17: 19,378,815 T254S probably benign Het
Zbed5 A G 5: 129,901,669 H132R possibly damaging Het
Zfp568 A G 7: 29,989,088 E25G probably damaging Het
Zfp951 T A 5: 104,817,000 I67L possibly damaging Het
Other mutations in Greb1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Greb1l APN 18 10555962 missense possibly damaging 0.90
IGL01554:Greb1l APN 18 10522144 missense probably benign 0.01
IGL01563:Greb1l APN 18 10469399 missense probably damaging 0.99
IGL01944:Greb1l APN 18 10557280 missense possibly damaging 0.91
IGL02110:Greb1l APN 18 10515271 missense probably damaging 1.00
IGL02249:Greb1l APN 18 10532961 missense probably damaging 1.00
IGL02318:Greb1l APN 18 10469388 missense possibly damaging 0.91
IGL02340:Greb1l APN 18 10515200 missense probably damaging 0.99
IGL02516:Greb1l APN 18 10537064 missense probably benign 0.31
IGL02566:Greb1l APN 18 10503299 missense probably damaging 0.99
IGL02583:Greb1l APN 18 10542362 missense probably damaging 1.00
IGL02838:Greb1l APN 18 10560430 missense probably damaging 1.00
A4554:Greb1l UTSW 18 10532862 missense possibly damaging 0.58
PIT4453001:Greb1l UTSW 18 10533031 missense probably damaging 0.98
PIT4453001:Greb1l UTSW 18 10533032 missense probably benign 0.08
R0099:Greb1l UTSW 18 10509158 missense probably damaging 1.00
R0226:Greb1l UTSW 18 10522076 intron probably benign
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0234:Greb1l UTSW 18 10560331 missense probably damaging 1.00
R0239:Greb1l UTSW 18 10458567 splice site probably benign
R0316:Greb1l UTSW 18 10547420 missense probably damaging 1.00
R0369:Greb1l UTSW 18 10469375 missense possibly damaging 0.80
R0394:Greb1l UTSW 18 10523374 missense probably damaging 0.99
R0478:Greb1l UTSW 18 10509281 missense probably damaging 1.00
R0555:Greb1l UTSW 18 10458781 splice site probably benign
R0671:Greb1l UTSW 18 10474303 missense probably damaging 1.00
R1282:Greb1l UTSW 18 10547289 missense probably benign 0.13
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1574:Greb1l UTSW 18 10554997 missense possibly damaging 0.95
R1607:Greb1l UTSW 18 10529703 missense possibly damaging 0.85
R1666:Greb1l UTSW 18 10501080 critical splice donor site probably null
R1666:Greb1l UTSW 18 10529708 critical splice donor site probably null
R1720:Greb1l UTSW 18 10553848 missense probably benign 0.19
R1808:Greb1l UTSW 18 10542143 missense probably benign
R1829:Greb1l UTSW 18 10509314 missense probably damaging 1.00
R1897:Greb1l UTSW 18 10498992 missense probably benign 0.00
R2025:Greb1l UTSW 18 10515221 missense possibly damaging 0.71
R2086:Greb1l UTSW 18 10523281 missense probably damaging 1.00
R2125:Greb1l UTSW 18 10511422 missense probably damaging 0.98
R2139:Greb1l UTSW 18 10555011 missense probably damaging 1.00
R2255:Greb1l UTSW 18 10554857 missense probably damaging 1.00
R2256:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2257:Greb1l UTSW 18 10503307 missense possibly damaging 0.91
R2880:Greb1l UTSW 18 10547288 missense possibly damaging 0.93
R3623:Greb1l UTSW 18 10542380 missense probably damaging 0.99
R3778:Greb1l UTSW 18 10469444 missense possibly damaging 0.60
R3975:Greb1l UTSW 18 10522247 missense possibly damaging 0.71
R4038:Greb1l UTSW 18 10515209 missense possibly damaging 0.93
R4062:Greb1l UTSW 18 10522150 missense probably damaging 0.99
R4134:Greb1l UTSW 18 10529708 critical splice donor site probably null
R4342:Greb1l UTSW 18 10544561 missense probably benign 0.12
R4409:Greb1l UTSW 18 10503182 missense possibly damaging 0.70
R4600:Greb1l UTSW 18 10553705 missense probably damaging 1.00
R4618:Greb1l UTSW 18 10498965 missense probably benign 0.00
R4683:Greb1l UTSW 18 10529563 splice site probably null
R4686:Greb1l UTSW 18 10522112 missense probably damaging 0.98
R4707:Greb1l UTSW 18 10532922 missense probably benign 0.02
R4780:Greb1l UTSW 18 10541792 missense probably benign 0.00
R4819:Greb1l UTSW 18 10458358 missense probably damaging 1.00
R4925:Greb1l UTSW 18 10547447 missense possibly damaging 0.79
R4960:Greb1l UTSW 18 10547306 missense probably damaging 0.99
R5150:Greb1l UTSW 18 10555950 frame shift probably null
R5154:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5269:Greb1l UTSW 18 10511409 missense probably benign
R5290:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5310:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5328:Greb1l UTSW 18 10553720 missense probably damaging 1.00
R5337:Greb1l UTSW 18 10509143 missense probably damaging 1.00
R5393:Greb1l UTSW 18 10458312 missense probably benign 0.02
R5402:Greb1l UTSW 18 10537169 missense probably benign 0.26
R5718:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5719:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5720:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5721:Greb1l UTSW 18 10542427 missense probably damaging 1.00
R5902:Greb1l UTSW 18 10538302 missense probably benign 0.00
R5993:Greb1l UTSW 18 10544455 missense probably benign 0.10
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6035:Greb1l UTSW 18 10501025 missense possibly damaging 0.91
R6045:Greb1l UTSW 18 10547068 missense probably damaging 1.00
R6063:Greb1l UTSW 18 10557340 missense probably damaging 1.00
R6297:Greb1l UTSW 18 10469494 missense probably damaging 1.00
R6405:Greb1l UTSW 18 10501076 missense probably benign 0.30
R6552:Greb1l UTSW 18 10541814 missense probably benign 0.00
R6572:Greb1l UTSW 18 10522131 missense probably benign 0.07
R6575:Greb1l UTSW 18 10547347 missense possibly damaging 0.88
R6922:Greb1l UTSW 18 10547482 missense possibly damaging 0.88
R6957:Greb1l UTSW 18 10558786 missense probably benign 0.23
R6962:Greb1l UTSW 18 10547327 missense probably damaging 1.00
R7012:Greb1l UTSW 18 10529707 critical splice donor site probably null
R7179:Greb1l UTSW 18 10544576 missense probably benign 0.00
R7251:Greb1l UTSW 18 10515319 missense probably damaging 1.00
R7275:Greb1l UTSW 18 10544561 missense probably benign 0.12
R7301:Greb1l UTSW 18 10544970 missense probably damaging 1.00
R7307:Greb1l UTSW 18 10538142 missense probably damaging 0.99
R7455:Greb1l UTSW 18 10554915 missense probably damaging 1.00
R7832:Greb1l UTSW 18 10542056 missense probably benign 0.38
R7934:Greb1l UTSW 18 10474371 nonsense probably null
R8137:Greb1l UTSW 18 10474357 missense possibly damaging 0.77
R8138:Greb1l UTSW 18 10533060 missense probably benign 0.13
R8208:Greb1l UTSW 18 10510703 missense probably damaging 1.00
R8227:Greb1l UTSW 18 10515371 missense probably damaging 1.00
R8312:Greb1l UTSW 18 10511587 intron probably benign
R8331:Greb1l UTSW 18 10458706 missense possibly damaging 0.96
R8364:Greb1l UTSW 18 10529687 missense possibly damaging 0.85
R8389:Greb1l UTSW 18 10529613 missense probably benign 0.00
R8695:Greb1l UTSW 18 10544450 missense probably benign 0.01
R8795:Greb1l UTSW 18 10553739 missense probably damaging 0.98
R8836:Greb1l UTSW 18 10509257 missense probably benign 0.30
R8862:Greb1l UTSW 18 10555042 missense possibly damaging 0.90
R8872:Greb1l UTSW 18 10529684 missense probably benign 0.18
R8874:Greb1l UTSW 18 10544896 missense probably benign 0.01
R8886:Greb1l UTSW 18 10553843 missense probably benign 0.21
R8921:Greb1l UTSW 18 10541825 missense probably benign 0.01
Z1176:Greb1l UTSW 18 10515305 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCCAGCTTTATGTATGGAAATC -3'
(R):5'- GAGATTCTTGAGGGCAAATGC -3'

Sequencing Primer
(F):5'- GCTCAGTAGTCATCTACAGTGATG -3'
(R):5'- GAGTGTAAAGAAGCCCAC -3'
Posted On2014-08-25