Mutagenetix > Incidental Mutation

Incidental Mutation 'R2008:Pkhd1'

219126

Institutional Source

Beutler Lab

Gene Symbol

Pkhd1

Ensembl Gene

ENSMUSG00000043760

Gene Name

polycystic kidney and hepatic disease 1

Synonyms

FPC, tigmin

MMRRC Submission

040017-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.136) question?

Stock #

R2008 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

20128003-20688288 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 20269683 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 3287 (V3287A)

Ref Sequence

ENSEMBL: ENSMUSP00000085794 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088448]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000088448
AA Change: V3287A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000085794
Gene: ENSMUSG00000043760
AA Change: V3287A

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Blast:IPT	134	254	1e-45	BLAST
IPT	256	353	1.13e-3	SMART
low complexity region	722	743	N/A	INTRINSIC
low complexity region	896	909	N/A	INTRINSIC
Pfam:TIG	936	1005	9.1e-8	PFAM
IPT	1016	1101	1.18e-6	SMART
IPT	1105	1190	1.27e0	SMART
IPT	1193	1290	7.05e-5	SMART
IPT	1384	1467	1.36e1	SMART
IPT	1568	1655	2.4e0	SMART
low complexity region	1881	1892	N/A	INTRINSIC
G8	1928	2049	1.15e-48	SMART
low complexity region	2079	2094	N/A	INTRINSIC
PbH1	2244	2266	7.82e3	SMART
PbH1	2287	2321	2.23e3	SMART
PbH1	2404	2426	7.19e2	SMART
PbH1	2459	2481	2.64e2	SMART
low complexity region	2713	2728	N/A	INTRINSIC
G8	2734	2867	1.73e-43	SMART
Blast:G8	2876	2923	2e-17	BLAST
PbH1	3004	3026	3.98e3	SMART
PbH1	3027	3049	1.27e0	SMART
PbH1	3080	3102	5.92e2	SMART
low complexity region	3178	3187	N/A	INTRINSIC
PbH1	3188	3212	8.08e3	SMART
transmembrane domain	3852	3874	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to have a single transmembrane (TM)-spanning domain and multiple copies of an immunoglobulin-like plexin-transcription-factor domain. Alternative splicing results in two transcript variants encoding different isoforms. Other alternatively spliced transcripts have been described, but the full length sequences have not been determined. Several of these transcripts are predicted to encode truncated products which lack the TM and may be secreted. Mutations in this gene cause autosomal recessive polycystic kidney disease, also known as polycystic kidney and hepatic disease-1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation in this gene display variable progressive liver cysts and fibrosis, but do not display kidney cysts and are fertile. Mice homozygous for a hypomorphic and null allele display renal, pancreatic, billiary and liver cysts. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted, knock-out(2) Targeted, other(4)

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2510039O18Rik	T	A	4: 148,026,034 (GRCm39)	C185S	probably benign	Het
Acsbg3	A	G	17: 57,193,478 (GRCm39)	N608S	probably benign	Het
Actl6b	T	A	5: 137,567,592 (GRCm39)	S409T	probably damaging	Het
Adam34l	A	T	8: 44,080,074 (GRCm39)	V50D	probably benign	Het
Adgrf2	T	C	17: 43,021,013 (GRCm39)	T604A	probably damaging	Het
Adprs	T	A	4: 126,211,137 (GRCm39)	D260V	probably benign	Het
Akap9	A	G	5: 4,010,131 (GRCm39)	E296G	possibly damaging	Het
Alg5	A	G	3: 54,653,894 (GRCm39)	Y210C	possibly damaging	Het
Aoc1	T	C	6: 48,882,831 (GRCm39)	W236R	probably damaging	Het
Atp11b	A	G	3: 35,909,271 (GRCm39)	D1155G	probably damaging	Het
Atp2c1	T	A	9: 105,309,925 (GRCm39)	T551S	probably benign	Het
Atp7b	A	T	8: 22,517,996 (GRCm39)	C281S	probably damaging	Het
Bmp1	C	T	14: 70,729,906 (GRCm39)	C466Y	probably damaging	Het
Cabin1	T	C	10: 75,570,810 (GRCm39)		probably null	Het
Capn9	T	G	8: 125,318,424 (GRCm39)	C97G	probably damaging	Het
Cbfa2t3	A	G	8: 123,370,032 (GRCm39)	V147A	probably damaging	Het
Ccdc83	T	A	7: 89,893,349 (GRCm39)	Y136F	probably damaging	Het
Cdh6	C	A	15: 13,051,562 (GRCm39)	R357L	possibly damaging	Het
Celf1	A	T	2: 90,840,753 (GRCm39)	N367I	probably damaging	Het
Cep350	T	C	1: 155,790,467 (GRCm39)	I1363V	probably benign	Het
Cfap299	C	T	5: 98,885,561 (GRCm39)	T156I	possibly damaging	Het
Colec12	T	A	18: 9,874,813 (GRCm39)	D696E	probably benign	Het
Ctbp1	C	T	5: 33,408,330 (GRCm39)	E138K	probably damaging	Het
Cyp4a10	T	C	4: 115,382,589 (GRCm39)	I293T	probably damaging	Het
Dclk2	G	A	3: 86,827,342 (GRCm39)	P46S	probably damaging	Het
Dctn1	C	T	6: 83,166,938 (GRCm39)	T263I	probably damaging	Het
Ddx49	A	T	8: 70,748,094 (GRCm39)	V317E	probably damaging	Het
Edil3	G	A	13: 89,093,072 (GRCm39)		probably null	Het
Egflam	A	T	15: 7,267,285 (GRCm39)	V700E	possibly damaging	Het
Fam168b	A	G	1: 34,858,946 (GRCm39)		probably null	Het
Gigyf2	T	G	1: 87,301,835 (GRCm39)		probably null	Het
H1f2	C	G	13: 23,923,392 (GRCm39)	S187R	probably benign	Het
Heatr4	A	G	12: 84,026,514 (GRCm39)	S248P	probably benign	Het
Hoxd1	A	T	2: 74,594,524 (GRCm39)	I260F	possibly damaging	Het
Hsd3b3	A	T	3: 98,649,408 (GRCm39)	L305Q	probably damaging	Het
Itch	T	A	2: 155,052,379 (GRCm39)	C660S	possibly damaging	Het
Ivd	A	T	2: 118,701,981 (GRCm39)	I138F	probably benign	Het
Katnip	C	G	7: 125,459,738 (GRCm39)	H1189D	probably damaging	Het
Lcn4	G	T	2: 26,561,228 (GRCm39)	Q18K	possibly damaging	Het
Mapkbp1	T	C	2: 119,843,146 (GRCm39)	Y192H	probably damaging	Het
Mn1	T	C	5: 111,566,723 (GRCm39)	L231P	probably damaging	Het
Morc1	A	G	16: 48,386,009 (GRCm39)	D544G	probably benign	Het
Mthfd1	C	A	12: 76,344,293 (GRCm39)	T331K	probably damaging	Het
Myo18b	T	A	5: 113,021,423 (GRCm39)	Y546F	probably benign	Het
Nod1	T	C	6: 54,916,310 (GRCm39)	Y129C	probably damaging	Het
Nprl3	A	G	11: 32,182,973 (GRCm39)	V563A	probably damaging	Het
Or13a18	T	C	7: 140,190,498 (GRCm39)	Y140H	probably damaging	Het
Or4a80	A	T	2: 89,582,417 (GRCm39)	C252S	possibly damaging	Het
Or5g29	A	G	2: 85,421,766 (GRCm39)	N294S	probably damaging	Het
Or5p72	T	C	7: 108,022,389 (GRCm39)	F204L	probably benign	Het
Or8b1b	T	C	9: 38,375,537 (GRCm39)	S67P	probably damaging	Het
Orc3	T	A	4: 34,611,049 (GRCm39)		probably null	Het
Otog	T	C	7: 45,913,498 (GRCm39)	V777A	probably benign	Het
Pbxip1	G	T	3: 89,356,020 (GRCm39)	V711L	probably benign	Het
Pcdhb16	A	G	18: 37,611,316 (GRCm39)	D92G	probably damaging	Het
Phkb	T	A	8: 86,783,096 (GRCm39)	M964K	probably damaging	Het
Pitpnm2	T	A	5: 124,290,684 (GRCm39)	M1L	probably damaging	Het
Polq	T	A	16: 36,882,844 (GRCm39)	H1669Q	probably damaging	Het
Ppp4r4	T	C	12: 103,552,016 (GRCm39)	S195P	probably damaging	Het
Prdm2	T	C	4: 142,861,517 (GRCm39)	Y591C	probably damaging	Het
Rgsl1	T	A	1: 153,701,651 (GRCm39)	T268S	possibly damaging	Het
Scd2	A	T	19: 44,291,610 (GRCm39)	T350S	probably benign	Het
Scn7a	T	A	2: 66,518,091 (GRCm39)	Q1040L	possibly damaging	Het
Sdhb	T	A	4: 140,706,340 (GRCm39)	L259Q	probably damaging	Het
Senp6	A	G	9: 80,033,680 (GRCm39)	H701R	probably damaging	Het
Slc41a2	C	T	10: 83,140,167 (GRCm39)		probably null	Het
Slx4	T	C	16: 3,797,785 (GRCm39)	D1533G	probably damaging	Het
Spef2	T	C	15: 9,713,271 (GRCm39)	K367R	possibly damaging	Het
Sstr3	G	A	15: 78,424,711 (GRCm39)	T12M	probably benign	Het
Synj2	G	T	17: 6,047,221 (GRCm39)	E20D	probably damaging	Het
Tchh	G	T	3: 93,353,281 (GRCm39)	R907L	unknown	Het
Thsd1	A	G	8: 22,749,247 (GRCm39)	E645G	probably benign	Het
Tmem176b	A	T	6: 48,812,383 (GRCm39)	M194K	probably damaging	Het
Tmprss11f	T	C	5: 86,739,265 (GRCm39)		probably null	Het
Trim44	G	A	2: 102,230,722 (GRCm39)		probably benign	Het
Triml1	T	A	8: 43,583,642 (GRCm39)	R320W	probably damaging	Het
Trmt6	A	T	2: 132,648,829 (GRCm39)	C401*	probably null	Het
Trpv5	T	C	6: 41,636,662 (GRCm39)		probably null	Het
V1rd19	T	A	7: 23,702,726 (GRCm39)	L64*	probably null	Het
Vmn1r216	A	T	13: 23,283,661 (GRCm39)	R115W	probably damaging	Het
Vmn2r58	T	C	7: 41,509,924 (GRCm39)	N551S	probably damaging	Het
Vmn2r77	T	C	7: 86,450,921 (GRCm39)	V269A	probably benign	Het
Vps13d	A	T	4: 144,881,813 (GRCm39)	V1254D	probably benign	Het
Xpr1	T	C	1: 155,156,775 (GRCm39)		probably null	Het
Zan	T	A	5: 137,450,712 (GRCm39)	T1622S	unknown	Het
Zfp112	T	C	7: 23,826,176 (GRCm39)	Y715H	probably damaging	Het
Zfp750	G	A	11: 121,403,951 (GRCm39)	P308L	possibly damaging	Het

Other mutations in Pkhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Pkhd1	APN	1	20,637,098 (GRCm39)	critical splice acceptor site	probably null
IGL00687:Pkhd1	APN	1	20,594,294 (GRCm39)	missense	probably benign	0.19
IGL00824:Pkhd1	APN	1	20,151,408 (GRCm39)	critical splice donor site	probably null
IGL00870:Pkhd1	APN	1	20,641,614 (GRCm39)	missense	probably damaging	1.00
IGL00911:Pkhd1	APN	1	20,187,971 (GRCm39)	missense	probably benign	0.00
IGL01015:Pkhd1	APN	1	20,593,482 (GRCm39)	missense	possibly damaging	0.95
IGL01025:Pkhd1	APN	1	20,279,400 (GRCm39)	missense	probably benign	0.04
IGL01064:Pkhd1	APN	1	20,604,754 (GRCm39)	splice site	probably benign
IGL01313:Pkhd1	APN	1	20,271,248 (GRCm39)	missense	probably damaging	1.00
IGL01340:Pkhd1	APN	1	20,593,201 (GRCm39)	missense	probably benign	0.01
IGL01352:Pkhd1	APN	1	20,619,939 (GRCm39)	missense	probably benign	0.34
IGL01456:Pkhd1	APN	1	20,269,683 (GRCm39)	missense	probably damaging	1.00
IGL01530:Pkhd1	APN	1	20,629,643 (GRCm39)	critical splice donor site	probably null
IGL01557:Pkhd1	APN	1	20,187,203 (GRCm39)	missense	possibly damaging	0.59
IGL01655:Pkhd1	APN	1	20,604,857 (GRCm39)	nonsense	probably null
IGL01790:Pkhd1	APN	1	20,628,895 (GRCm39)	missense	probably damaging	0.96
IGL01862:Pkhd1	APN	1	20,429,134 (GRCm39)	missense	probably damaging	1.00
IGL01874:Pkhd1	APN	1	20,173,459 (GRCm39)	missense	probably benign	0.32
IGL01901:Pkhd1	APN	1	20,290,307 (GRCm39)	missense	probably benign	0.11
IGL01903:Pkhd1	APN	1	20,268,361 (GRCm39)	missense	probably damaging	1.00
IGL01981:Pkhd1	APN	1	20,593,791 (GRCm39)	missense	possibly damaging	0.64
IGL02068:Pkhd1	APN	1	20,592,971 (GRCm39)	missense	probably damaging	1.00
IGL02083:Pkhd1	APN	1	20,271,451 (GRCm39)	missense	probably damaging	1.00
IGL02084:Pkhd1	APN	1	20,447,623 (GRCm39)	missense	probably damaging	1.00
IGL02126:Pkhd1	APN	1	20,187,419 (GRCm39)	missense	probably damaging	1.00
IGL02136:Pkhd1	APN	1	20,345,839 (GRCm39)	missense	probably damaging	1.00
IGL02255:Pkhd1	APN	1	20,654,325 (GRCm39)	missense	probably damaging	1.00
IGL02272:Pkhd1	APN	1	20,279,484 (GRCm39)	missense	probably damaging	1.00
IGL02308:Pkhd1	APN	1	20,140,600 (GRCm39)	critical splice donor site	probably null
IGL02364:Pkhd1	APN	1	20,271,007 (GRCm39)	missense	probably benign
IGL02389:Pkhd1	APN	1	20,187,944 (GRCm39)	missense	probably damaging	0.99
IGL02394:Pkhd1	APN	1	20,269,710 (GRCm39)	missense	possibly damaging	0.57
IGL02403:Pkhd1	APN	1	20,632,642 (GRCm39)	missense	probably benign	0.01
IGL02415:Pkhd1	APN	1	20,484,645 (GRCm39)	missense	probably damaging	1.00
IGL02415:Pkhd1	APN	1	20,592,983 (GRCm39)	missense	probably damaging	1.00
IGL02455:Pkhd1	APN	1	20,434,425 (GRCm39)	missense	probably damaging	1.00
IGL02502:Pkhd1	APN	1	20,462,389 (GRCm39)	missense	probably damaging	1.00
IGL02511:Pkhd1	APN	1	20,143,731 (GRCm39)	missense	possibly damaging	0.90
IGL02530:Pkhd1	APN	1	20,187,944 (GRCm39)	missense	probably damaging	0.99
IGL02532:Pkhd1	APN	1	20,187,944 (GRCm39)	missense	probably damaging	0.99
IGL02534:Pkhd1	APN	1	20,187,944 (GRCm39)	missense	probably damaging	0.99
IGL02556:Pkhd1	APN	1	20,380,934 (GRCm39)	missense	probably damaging	1.00
IGL02570:Pkhd1	APN	1	20,590,480 (GRCm39)	missense	probably damaging	0.99
IGL02605:Pkhd1	APN	1	20,621,126 (GRCm39)	missense	possibly damaging	0.66
IGL02641:Pkhd1	APN	1	20,628,976 (GRCm39)	missense	possibly damaging	0.61
IGL02741:Pkhd1	APN	1	20,290,253 (GRCm39)	splice site	probably benign
IGL02752:Pkhd1	APN	1	20,623,815 (GRCm39)	missense	possibly damaging	0.57
IGL02890:Pkhd1	APN	1	20,431,235 (GRCm39)	missense	probably damaging	1.00
IGL02959:Pkhd1	APN	1	20,678,640 (GRCm39)	nonsense	probably null
IGL02960:Pkhd1	APN	1	20,447,670 (GRCm39)	missense	possibly damaging	0.69
IGL02990:Pkhd1	APN	1	20,593,187 (GRCm39)	missense	possibly damaging	0.52
IGL03037:Pkhd1	APN	1	20,592,923 (GRCm39)	missense	probably benign	0.06
IGL03082:Pkhd1	APN	1	20,635,857 (GRCm39)	missense	probably damaging	1.00
IGL03114:Pkhd1	APN	1	20,268,395 (GRCm39)	missense	probably damaging	0.99
IGL03288:Pkhd1	APN	1	20,271,243 (GRCm39)	missense	probably benign	0.01
IGL03328:Pkhd1	APN	1	20,151,524 (GRCm39)	splice site	probably benign
IGL03375:Pkhd1	APN	1	20,187,247 (GRCm39)	missense	probably damaging	1.00
IGL03380:Pkhd1	APN	1	20,270,894 (GRCm39)	missense	probably damaging	1.00
0152:Pkhd1	UTSW	1	20,593,118 (GRCm39)	missense	possibly damaging	0.46
IGL03046:Pkhd1	UTSW	1	20,607,589 (GRCm39)	missense	possibly damaging	0.81
LCD18:Pkhd1	UTSW	1	20,681,638 (GRCm39)	intron	probably benign
P0035:Pkhd1	UTSW	1	20,187,571 (GRCm39)	missense	probably benign	0.00
PIT4260001:Pkhd1	UTSW	1	20,293,130 (GRCm39)	missense	possibly damaging	0.51
R0063:Pkhd1	UTSW	1	20,282,174 (GRCm39)	missense	probably benign	0.02
R0063:Pkhd1	UTSW	1	20,282,174 (GRCm39)	missense	probably benign	0.02
R0071:Pkhd1	UTSW	1	20,271,568 (GRCm39)	missense	probably benign	0.11
R0071:Pkhd1	UTSW	1	20,271,568 (GRCm39)	missense	probably benign	0.11
R0094:Pkhd1	UTSW	1	20,279,470 (GRCm39)	missense	probably damaging	1.00
R0094:Pkhd1	UTSW	1	20,279,470 (GRCm39)	missense	probably damaging	1.00
R0103:Pkhd1	UTSW	1	20,593,583 (GRCm39)	missense	probably benign	0.04
R0103:Pkhd1	UTSW	1	20,593,583 (GRCm39)	missense	probably benign	0.04
R0105:Pkhd1	UTSW	1	20,593,956 (GRCm39)	nonsense	probably null
R0105:Pkhd1	UTSW	1	20,593,956 (GRCm39)	nonsense	probably null
R0115:Pkhd1	UTSW	1	20,420,714 (GRCm39)	missense	probably damaging	1.00
R0193:Pkhd1	UTSW	1	20,429,141 (GRCm39)	missense	probably damaging	1.00
R0245:Pkhd1	UTSW	1	20,610,624 (GRCm39)	missense	probably benign	0.03
R0277:Pkhd1	UTSW	1	20,345,762 (GRCm39)	missense	probably benign	0.04
R0310:Pkhd1	UTSW	1	20,620,046 (GRCm39)	splice site	probably null
R0323:Pkhd1	UTSW	1	20,345,762 (GRCm39)	missense	probably benign	0.04
R0395:Pkhd1	UTSW	1	20,451,771 (GRCm39)	missense	probably benign	0.26
R0412:Pkhd1	UTSW	1	20,188,012 (GRCm39)	missense	probably damaging	1.00
R0506:Pkhd1	UTSW	1	20,629,693 (GRCm39)	missense	probably benign	0.00
R0512:Pkhd1	UTSW	1	20,380,738 (GRCm39)	splice site	probably benign
R0550:Pkhd1	UTSW	1	20,417,447 (GRCm39)	missense	probably null	1.00
R0584:Pkhd1	UTSW	1	20,309,660 (GRCm39)	nonsense	probably null
R0586:Pkhd1	UTSW	1	20,594,335 (GRCm39)	missense	probably benign	0.04
R0598:Pkhd1	UTSW	1	20,271,114 (GRCm39)	missense	probably damaging	1.00
R0603:Pkhd1	UTSW	1	20,187,397 (GRCm39)	missense	probably benign	0.05
R0634:Pkhd1	UTSW	1	20,187,698 (GRCm39)	missense	probably damaging	1.00
R0677:Pkhd1	UTSW	1	20,594,454 (GRCm39)	missense	probably benign	0.01
R0746:Pkhd1	UTSW	1	20,268,331 (GRCm39)	missense	probably damaging	1.00
R0781:Pkhd1	UTSW	1	20,187,708 (GRCm39)	missense	probably benign	0.01
R0840:Pkhd1	UTSW	1	20,420,745 (GRCm39)	missense	probably damaging	0.98
R0946:Pkhd1	UTSW	1	20,269,605 (GRCm39)	missense	probably benign	0.10
R1018:Pkhd1	UTSW	1	20,271,483 (GRCm39)	missense	possibly damaging	0.89
R1028:Pkhd1	UTSW	1	20,187,950 (GRCm39)	missense	probably damaging	1.00
R1136:Pkhd1	UTSW	1	20,593,053 (GRCm39)	missense	possibly damaging	0.68
R1178:Pkhd1	UTSW	1	20,655,381 (GRCm39)	critical splice donor site	probably null
R1180:Pkhd1	UTSW	1	20,655,381 (GRCm39)	critical splice donor site	probably null
R1222:Pkhd1	UTSW	1	20,637,680 (GRCm39)	missense	probably benign	0.07
R1334:Pkhd1	UTSW	1	20,604,129 (GRCm39)	missense	possibly damaging	0.81
R1335:Pkhd1	UTSW	1	20,641,629 (GRCm39)	missense	probably damaging	1.00
R1387:Pkhd1	UTSW	1	20,625,447 (GRCm39)	splice site	probably benign
R1411:Pkhd1	UTSW	1	20,444,120 (GRCm39)	missense	probably damaging	1.00
R1443:Pkhd1	UTSW	1	20,604,782 (GRCm39)	missense	probably damaging	1.00
R1448:Pkhd1	UTSW	1	20,655,381 (GRCm39)	critical splice donor site	probably null
R1468:Pkhd1	UTSW	1	20,593,565 (GRCm39)	missense	probably damaging	1.00
R1468:Pkhd1	UTSW	1	20,593,565 (GRCm39)	missense	probably damaging	1.00
R1473:Pkhd1	UTSW	1	20,593,207 (GRCm39)	missense	probably benign	0.00
R1524:Pkhd1	UTSW	1	20,188,004 (GRCm39)	missense	probably damaging	1.00
R1532:Pkhd1	UTSW	1	20,187,625 (GRCm39)	missense	probably benign	0.08
R1565:Pkhd1	UTSW	1	20,417,681 (GRCm39)	missense	probably damaging	1.00
R1572:Pkhd1	UTSW	1	20,417,664 (GRCm39)	missense	probably benign	0.02
R1583:Pkhd1	UTSW	1	20,188,049 (GRCm39)	missense	probably benign
R1617:Pkhd1	UTSW	1	20,268,274 (GRCm39)	missense	possibly damaging	0.95
R1631:Pkhd1	UTSW	1	20,593,121 (GRCm39)	missense	probably benign	0.06
R1655:Pkhd1	UTSW	1	20,654,353 (GRCm39)	missense	probably damaging	1.00
R1707:Pkhd1	UTSW	1	20,621,064 (GRCm39)	splice site	probably benign
R1753:Pkhd1	UTSW	1	20,604,129 (GRCm39)	missense	possibly damaging	0.81
R1782:Pkhd1	UTSW	1	20,635,935 (GRCm39)	missense	probably damaging	0.98
R1791:Pkhd1	UTSW	1	20,655,376 (GRCm39)	splice site	probably benign
R1822:Pkhd1	UTSW	1	20,417,681 (GRCm39)	missense	probably damaging	1.00
R1823:Pkhd1	UTSW	1	20,417,681 (GRCm39)	missense	probably damaging	1.00
R1824:Pkhd1	UTSW	1	20,417,681 (GRCm39)	missense	probably damaging	1.00
R1836:Pkhd1	UTSW	1	20,187,293 (GRCm39)	missense	probably benign	0.01
R1862:Pkhd1	UTSW	1	20,621,244 (GRCm39)	missense	probably benign	0.00
R1863:Pkhd1	UTSW	1	20,621,244 (GRCm39)	missense	probably benign	0.00
R1869:Pkhd1	UTSW	1	20,685,491 (GRCm39)	critical splice donor site	probably null
R1913:Pkhd1	UTSW	1	20,636,980 (GRCm39)	critical splice donor site	probably null
R1928:Pkhd1	UTSW	1	20,151,524 (GRCm39)	splice site	probably benign
R1969:Pkhd1	UTSW	1	20,451,747 (GRCm39)	missense	probably damaging	1.00
R1970:Pkhd1	UTSW	1	20,451,747 (GRCm39)	missense	probably damaging	1.00
R1981:Pkhd1	UTSW	1	20,187,284 (GRCm39)	missense	probably benign	0.00
R2034:Pkhd1	UTSW	1	20,270,893 (GRCm39)	missense	probably damaging	1.00
R2061:Pkhd1	UTSW	1	20,683,036 (GRCm39)	missense	possibly damaging	0.76
R2062:Pkhd1	UTSW	1	20,271,559 (GRCm39)	missense	probably damaging	0.97
R2108:Pkhd1	UTSW	1	20,623,798 (GRCm39)	nonsense	probably null
R2142:Pkhd1	UTSW	1	20,594,119 (GRCm39)	missense	probably benign	0.00
R2148:Pkhd1	UTSW	1	20,484,444 (GRCm39)	critical splice donor site	probably null
R2176:Pkhd1	UTSW	1	20,623,741 (GRCm39)	missense	probably damaging	1.00
R2202:Pkhd1	UTSW	1	20,607,584 (GRCm39)	missense	probably benign	0.06
R2255:Pkhd1	UTSW	1	20,635,863 (GRCm39)	missense	probably benign	0.23
R2269:Pkhd1	UTSW	1	20,604,759 (GRCm39)	critical splice donor site	probably null
R2275:Pkhd1	UTSW	1	20,271,073 (GRCm39)	missense	possibly damaging	0.95
R2340:Pkhd1	UTSW	1	20,271,079 (GRCm39)	missense	probably damaging	1.00
R2431:Pkhd1	UTSW	1	20,271,389 (GRCm39)	missense	possibly damaging	0.63
R2679:Pkhd1	UTSW	1	20,279,406 (GRCm39)	missense	probably benign	0.03
R2850:Pkhd1	UTSW	1	20,579,300 (GRCm39)	missense	possibly damaging	0.89
R2851:Pkhd1	UTSW	1	20,128,526 (GRCm39)	missense	probably benign	0.16
R2853:Pkhd1	UTSW	1	20,128,526 (GRCm39)	missense	probably benign	0.16
R2984:Pkhd1	UTSW	1	20,293,185 (GRCm39)	missense	possibly damaging	0.84
R2987:Pkhd1	UTSW	1	20,174,823 (GRCm39)	missense	possibly damaging	0.87
R3692:Pkhd1	UTSW	1	20,625,353 (GRCm39)	missense	possibly damaging	0.87
R3721:Pkhd1	UTSW	1	20,655,879 (GRCm39)	missense	probably benign	0.08
R3746:Pkhd1	UTSW	1	20,128,524 (GRCm39)	makesense	probably null
R3838:Pkhd1	UTSW	1	20,604,853 (GRCm39)	missense	possibly damaging	0.66
R3843:Pkhd1	UTSW	1	20,628,947 (GRCm39)	missense	probably benign	0.00
R3861:Pkhd1	UTSW	1	20,271,151 (GRCm39)	missense	probably damaging	1.00
R3893:Pkhd1	UTSW	1	20,382,362 (GRCm39)	nonsense	probably null
R3926:Pkhd1	UTSW	1	20,621,097 (GRCm39)	missense	probably benign	0.00
R4183:Pkhd1	UTSW	1	20,188,031 (GRCm39)	missense	probably benign	0.03
R4184:Pkhd1	UTSW	1	20,633,910 (GRCm39)	missense	probably benign	0.06
R4184:Pkhd1	UTSW	1	20,279,501 (GRCm39)	missense	probably benign	0.03
R4255:Pkhd1	UTSW	1	20,664,158 (GRCm39)	missense	probably damaging	0.99
R4275:Pkhd1	UTSW	1	20,128,608 (GRCm39)	missense	probably benign	0.00
R4342:Pkhd1	UTSW	1	20,128,841 (GRCm39)	missense	probably benign	0.00
R4386:Pkhd1	UTSW	1	20,484,516 (GRCm39)	missense	probably benign	0.00
R4402:Pkhd1	UTSW	1	20,309,635 (GRCm39)	missense	probably damaging	1.00
R4431:Pkhd1	UTSW	1	20,593,538 (GRCm39)	missense	probably damaging	0.99
R4560:Pkhd1	UTSW	1	20,282,082 (GRCm39)	missense	probably damaging	1.00
R4561:Pkhd1	UTSW	1	20,604,943 (GRCm39)	missense	possibly damaging	0.89
R4570:Pkhd1	UTSW	1	20,451,747 (GRCm39)	missense	probably damaging	1.00
R4571:Pkhd1	UTSW	1	20,683,633 (GRCm39)	missense	probably damaging	1.00
R4588:Pkhd1	UTSW	1	20,271,092 (GRCm39)	missense	probably benign	0.00
R4598:Pkhd1	UTSW	1	20,573,280 (GRCm39)	missense	probably damaging	1.00
R4651:Pkhd1	UTSW	1	20,451,747 (GRCm39)	missense	probably damaging	1.00
R4657:Pkhd1	UTSW	1	20,434,391 (GRCm39)	missense	possibly damaging	0.89
R4718:Pkhd1	UTSW	1	20,151,452 (GRCm39)	missense	probably damaging	1.00
R4740:Pkhd1	UTSW	1	20,594,354 (GRCm39)	missense	probably benign
R4750:Pkhd1	UTSW	1	20,594,336 (GRCm39)	missense	possibly damaging	0.57
R4816:Pkhd1	UTSW	1	20,269,639 (GRCm39)	missense	probably damaging	0.99
R4825:Pkhd1	UTSW	1	20,607,625 (GRCm39)	missense	probably damaging	0.96
R4885:Pkhd1	UTSW	1	20,140,712 (GRCm39)	missense	possibly damaging	0.55
R4907:Pkhd1	UTSW	1	20,279,450 (GRCm39)	missense	probably damaging	1.00
R4944:Pkhd1	UTSW	1	20,358,429 (GRCm39)	missense	probably null	0.01
R5062:Pkhd1	UTSW	1	20,655,935 (GRCm39)	missense	probably benign	0.00
R5090:Pkhd1	UTSW	1	20,270,981 (GRCm39)	missense	probably damaging	1.00
R5104:Pkhd1	UTSW	1	20,655,415 (GRCm39)	missense	probably damaging	1.00
R5187:Pkhd1	UTSW	1	20,279,448 (GRCm39)	missense	possibly damaging	0.67
R5202:Pkhd1	UTSW	1	20,617,565 (GRCm39)	missense	probably benign	0.01
R5240:Pkhd1	UTSW	1	20,345,865 (GRCm39)	missense	probably benign	0.04
R5248:Pkhd1	UTSW	1	20,604,769 (GRCm39)	missense	probably benign	0.00
R5252:Pkhd1	UTSW	1	20,420,635 (GRCm39)	critical splice donor site	probably null
R5293:Pkhd1	UTSW	1	20,579,300 (GRCm39)	missense	possibly damaging	0.89
R5311:Pkhd1	UTSW	1	20,636,094 (GRCm39)	missense	possibly damaging	0.94
R5317:Pkhd1	UTSW	1	20,520,528 (GRCm39)	missense	probably damaging	1.00
R5346:Pkhd1	UTSW	1	20,593,658 (GRCm39)	missense	probably damaging	0.96
R5346:Pkhd1	UTSW	1	20,462,321 (GRCm39)	missense	probably benign
R5431:Pkhd1	UTSW	1	20,188,060 (GRCm39)	missense	probably benign	0.25
R5447:Pkhd1	UTSW	1	20,309,609 (GRCm39)	missense	probably benign	0.00
R5478:Pkhd1	UTSW	1	20,271,380 (GRCm39)	missense	probably damaging	1.00
R5497:Pkhd1	UTSW	1	20,447,628 (GRCm39)	missense	possibly damaging	0.94
R5554:Pkhd1	UTSW	1	20,151,476 (GRCm39)	missense	probably damaging	0.99
R5579:Pkhd1	UTSW	1	20,593,366 (GRCm39)	missense	probably damaging	0.96
R5614:Pkhd1	UTSW	1	20,143,750 (GRCm39)	missense	possibly damaging	0.83
R5648:Pkhd1	UTSW	1	20,628,850 (GRCm39)	missense	probably benign	0.04
R5651:Pkhd1	UTSW	1	20,188,031 (GRCm39)	missense	probably benign	0.03
R5665:Pkhd1	UTSW	1	20,658,755 (GRCm39)	missense	probably damaging	1.00
R5681:Pkhd1	UTSW	1	20,617,685 (GRCm39)	missense	possibly damaging	0.61
R5754:Pkhd1	UTSW	1	20,593,875 (GRCm39)	nonsense	probably null
R5760:Pkhd1	UTSW	1	20,143,778 (GRCm39)	missense	probably benign	0.02
R5776:Pkhd1	UTSW	1	20,279,409 (GRCm39)	missense	possibly damaging	0.62
R5782:Pkhd1	UTSW	1	20,128,824 (GRCm39)	missense	probably benign
R5810:Pkhd1	UTSW	1	20,270,897 (GRCm39)	missense	probably benign	0.26
R5814:Pkhd1	UTSW	1	20,269,629 (GRCm39)	missense	probably damaging	1.00
R5816:Pkhd1	UTSW	1	20,128,902 (GRCm39)	missense	probably benign	0.03
R5835:Pkhd1	UTSW	1	20,271,307 (GRCm39)	missense	probably benign	0.01
R5844:Pkhd1	UTSW	1	20,451,685 (GRCm39)	missense	probably benign	0.00
R5847:Pkhd1	UTSW	1	20,444,960 (GRCm39)	nonsense	probably null
R5852:Pkhd1	UTSW	1	20,447,632 (GRCm39)	missense	probably benign	0.22
R5863:Pkhd1	UTSW	1	20,590,434 (GRCm39)	missense	possibly damaging	0.63
R6213:Pkhd1	UTSW	1	20,593,994 (GRCm39)	missense	possibly damaging	0.80
R6351:Pkhd1	UTSW	1	20,282,175 (GRCm39)	missense	probably benign	0.00
R6386:Pkhd1	UTSW	1	20,621,244 (GRCm39)	missense	probably damaging	0.96
R6542:Pkhd1	UTSW	1	20,655,927 (GRCm39)	missense	probably benign	0.02
R6579:Pkhd1	UTSW	1	20,271,047 (GRCm39)	missense	probably benign	0.01
R6658:Pkhd1	UTSW	1	20,682,929 (GRCm39)	missense	probably damaging	1.00
R6765:Pkhd1	UTSW	1	20,128,563 (GRCm39)	missense	probably benign
R6886:Pkhd1	UTSW	1	20,417,504 (GRCm39)	missense	probably benign	0.01
R6892:Pkhd1	UTSW	1	20,593,739 (GRCm39)	missense	probably damaging	1.00
R6900:Pkhd1	UTSW	1	20,604,925 (GRCm39)	missense	probably benign	0.06
R6932:Pkhd1	UTSW	1	20,632,675 (GRCm39)	missense	probably benign	0.19
R7191:Pkhd1	UTSW	1	20,628,943 (GRCm39)	missense	probably benign	0.00
R7220:Pkhd1	UTSW	1	20,593,350 (GRCm39)	missense	possibly damaging	0.89
R7329:Pkhd1	UTSW	1	20,617,743 (GRCm39)	missense	probably damaging	0.96
R7361:Pkhd1	UTSW	1	20,664,177 (GRCm39)	missense	probably damaging	1.00
R7381:Pkhd1	UTSW	1	20,271,197 (GRCm39)	missense	probably damaging	1.00
R7388:Pkhd1	UTSW	1	20,309,528 (GRCm39)	missense	not run
R7436:Pkhd1	UTSW	1	20,270,925 (GRCm39)	missense	probably benign
R7473:Pkhd1	UTSW	1	20,619,980 (GRCm39)	missense	probably damaging	0.99
R7578:Pkhd1	UTSW	1	20,417,585 (GRCm39)	missense	probably damaging	1.00
R7751:Pkhd1	UTSW	1	20,271,149 (GRCm39)	missense	probably damaging	1.00
R7755:Pkhd1	UTSW	1	20,617,717 (GRCm39)	missense	probably damaging	0.98
R7757:Pkhd1	UTSW	1	20,632,639 (GRCm39)	missense	probably damaging	1.00
R7832:Pkhd1	UTSW	1	20,573,223 (GRCm39)	missense	probably damaging	1.00
R7834:Pkhd1	UTSW	1	20,382,273 (GRCm39)	missense	probably benign
R7920:Pkhd1	UTSW	1	20,345,759 (GRCm39)	missense	probably damaging	1.00
R8014:Pkhd1	UTSW	1	20,579,115 (GRCm39)	critical splice donor site	probably null
R8034:Pkhd1	UTSW	1	20,451,662 (GRCm39)	missense	possibly damaging	0.94
R8085:Pkhd1	UTSW	1	20,683,639 (GRCm39)	missense	probably damaging	1.00
R8087:Pkhd1	UTSW	1	20,593,313 (GRCm39)	missense	probably damaging	1.00
R8103:Pkhd1	UTSW	1	20,270,981 (GRCm39)	missense	probably damaging	1.00
R8122:Pkhd1	UTSW	1	20,632,682 (GRCm39)	missense	probably damaging	1.00
R8273:Pkhd1	UTSW	1	20,607,644 (GRCm39)	splice site	probably benign
R8485:Pkhd1	UTSW	1	20,593,257 (GRCm39)	missense	probably damaging	1.00
R8504:Pkhd1	UTSW	1	20,590,432 (GRCm39)	missense	probably benign	0.10
R8544:Pkhd1	UTSW	1	20,593,199 (GRCm39)	missense	probably damaging	1.00
R8692:Pkhd1	UTSW	1	20,462,374 (GRCm39)	missense	probably damaging	1.00
R8787:Pkhd1	UTSW	1	20,358,461 (GRCm39)	missense	probably damaging	0.99
R8853:Pkhd1	UTSW	1	20,143,679 (GRCm39)	critical splice donor site	probably null
R8907:Pkhd1	UTSW	1	20,187,785 (GRCm39)	missense	possibly damaging	0.88
R8934:Pkhd1	UTSW	1	20,462,234 (GRCm39)	critical splice donor site	probably null
R8990:Pkhd1	UTSW	1	20,417,529 (GRCm39)	missense	probably benign	0.00
R8998:Pkhd1	UTSW	1	20,434,425 (GRCm39)	missense	probably damaging	1.00
R9024:Pkhd1	UTSW	1	20,592,975 (GRCm39)	missense	probably benign	0.24
R9035:Pkhd1	UTSW	1	20,573,176 (GRCm39)	missense	probably damaging	1.00
R9092:Pkhd1	UTSW	1	20,632,586 (GRCm39)	missense	probably benign	0.00
R9238:Pkhd1	UTSW	1	20,604,799 (GRCm39)	missense	possibly damaging	0.89
R9258:Pkhd1	UTSW	1	20,444,174 (GRCm39)	missense	probably damaging	0.99
R9262:Pkhd1	UTSW	1	20,618,351 (GRCm39)	missense	probably benign	0.01
R9297:Pkhd1	UTSW	1	20,293,118 (GRCm39)	missense	probably benign	0.06
R9452:Pkhd1	UTSW	1	20,682,953 (GRCm39)	missense	possibly damaging	0.77
R9515:Pkhd1	UTSW	1	20,637,741 (GRCm39)	missense	probably damaging	1.00
R9540:Pkhd1	UTSW	1	20,269,570 (GRCm39)	missense	probably benign	0.00
R9542:Pkhd1	UTSW	1	20,188,004 (GRCm39)	missense	probably damaging	1.00
R9629:Pkhd1	UTSW	1	20,462,437 (GRCm39)	missense	possibly damaging	0.63
R9644:Pkhd1	UTSW	1	20,617,690 (GRCm39)	missense	probably benign	0.04
R9739:Pkhd1	UTSW	1	20,420,708 (GRCm39)	missense	probably damaging	1.00
R9767:Pkhd1	UTSW	1	20,484,636 (GRCm39)	missense	probably benign
R9781:Pkhd1	UTSW	1	20,187,665 (GRCm39)	missense	possibly damaging	0.95
R9803:Pkhd1	UTSW	1	20,637,073 (GRCm39)	missense	probably damaging	1.00
X0012:Pkhd1	UTSW	1	20,444,150 (GRCm39)	missense	probably damaging	1.00
X0067:Pkhd1	UTSW	1	20,590,450 (GRCm39)	missense	probably damaging	1.00
Z1176:Pkhd1	UTSW	1	20,593,971 (GRCm39)	missense	possibly damaging	0.81
Z1177:Pkhd1	UTSW	1	20,593,845 (GRCm39)	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20,380,818 (GRCm39)	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20,188,107 (GRCm39)	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20,621,243 (GRCm39)	missense	probably benign
Z1177:Pkhd1	UTSW	1	20,594,162 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCCTTTTCTACAGGGGTTTATTTC -3'
(R):5'- TGTCCTGGATAGCTCAAATTAGTTC -3'

Sequencing Primer
(F):5'- GTTTGGGGATTTAAGCAGTTGAAAAC -3'
(R):5'- AGCTCAAATTAGTTCCTGGAATATG -3'

Posted On

2014-08-25