Incidental Mutation 'R2008:Fam168b'
ID 219128
Institutional Source Beutler Lab
Gene Symbol Fam168b
Ensembl Gene ENSMUSG00000037503
Gene Name family with sequence similarity 168, member B
Synonyms
MMRRC Submission 040017-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R2008 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 34852307-34882094 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 34858946 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140573 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047534] [ENSMUST00000047534] [ENSMUST00000167518] [ENSMUST00000167518] [ENSMUST00000170092] [ENSMUST00000170092] [ENSMUST00000185231] [ENSMUST00000185231] [ENSMUST00000185469] [ENSMUST00000191307] [ENSMUST00000191307]
AlphaFold Q80XQ8
Predicted Effect probably null
Transcript: ENSMUST00000047534
SMART Domains Protein: ENSMUSP00000042212
Gene: ENSMUSG00000037503

DomainStartEndE-ValueType
Pfam:TCRP1 1 194 1e-108 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000047534
SMART Domains Protein: ENSMUSP00000042212
Gene: ENSMUSG00000037503

DomainStartEndE-ValueType
Pfam:TCRP1 1 194 1e-108 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000167518
SMART Domains Protein: ENSMUSP00000131720
Gene: ENSMUSG00000037503

DomainStartEndE-ValueType
Pfam:TCRP1 1 62 3.3e-26 PFAM
Pfam:TCRP1 54 206 1.1e-89 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000167518
SMART Domains Protein: ENSMUSP00000131720
Gene: ENSMUSG00000037503

DomainStartEndE-ValueType
Pfam:TCRP1 1 62 3.3e-26 PFAM
Pfam:TCRP1 54 206 1.1e-89 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170092
SMART Domains Protein: ENSMUSP00000128676
Gene: ENSMUSG00000037503

DomainStartEndE-ValueType
Pfam:TCRP1 1 201 8.8e-108 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170092
SMART Domains Protein: ENSMUSP00000128676
Gene: ENSMUSG00000037503

DomainStartEndE-ValueType
Pfam:TCRP1 1 201 8.8e-108 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000185231
SMART Domains Protein: ENSMUSP00000139456
Gene: ENSMUSG00000037503

DomainStartEndE-ValueType
Pfam:TCRP1 1 90 7.5e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000185231
SMART Domains Protein: ENSMUSP00000139456
Gene: ENSMUSG00000037503

DomainStartEndE-ValueType
Pfam:TCRP1 1 90 7.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185279
Predicted Effect probably benign
Transcript: ENSMUST00000185469
SMART Domains Protein: ENSMUSP00000141150
Gene: ENSMUSG00000037503

DomainStartEndE-ValueType
Pfam:TCRP1 1 66 3.6e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000191307
SMART Domains Protein: ENSMUSP00000140573
Gene: ENSMUSG00000037503

DomainStartEndE-ValueType
Pfam:TCRP1 1 206 2.8e-108 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000191307
SMART Domains Protein: ENSMUSP00000140573
Gene: ENSMUSG00000037503

DomainStartEndE-ValueType
Pfam:TCRP1 1 206 2.8e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192924
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik T A 4: 148,026,034 (GRCm39) C185S probably benign Het
Acsbg3 A G 17: 57,193,478 (GRCm39) N608S probably benign Het
Actl6b T A 5: 137,567,592 (GRCm39) S409T probably damaging Het
Adam34l A T 8: 44,080,074 (GRCm39) V50D probably benign Het
Adgrf2 T C 17: 43,021,013 (GRCm39) T604A probably damaging Het
Adprs T A 4: 126,211,137 (GRCm39) D260V probably benign Het
Akap9 A G 5: 4,010,131 (GRCm39) E296G possibly damaging Het
Alg5 A G 3: 54,653,894 (GRCm39) Y210C possibly damaging Het
Aoc1 T C 6: 48,882,831 (GRCm39) W236R probably damaging Het
Atp11b A G 3: 35,909,271 (GRCm39) D1155G probably damaging Het
Atp2c1 T A 9: 105,309,925 (GRCm39) T551S probably benign Het
Atp7b A T 8: 22,517,996 (GRCm39) C281S probably damaging Het
Bmp1 C T 14: 70,729,906 (GRCm39) C466Y probably damaging Het
Cabin1 T C 10: 75,570,810 (GRCm39) probably null Het
Capn9 T G 8: 125,318,424 (GRCm39) C97G probably damaging Het
Cbfa2t3 A G 8: 123,370,032 (GRCm39) V147A probably damaging Het
Ccdc83 T A 7: 89,893,349 (GRCm39) Y136F probably damaging Het
Cdh6 C A 15: 13,051,562 (GRCm39) R357L possibly damaging Het
Celf1 A T 2: 90,840,753 (GRCm39) N367I probably damaging Het
Cep350 T C 1: 155,790,467 (GRCm39) I1363V probably benign Het
Cfap299 C T 5: 98,885,561 (GRCm39) T156I possibly damaging Het
Colec12 T A 18: 9,874,813 (GRCm39) D696E probably benign Het
Ctbp1 C T 5: 33,408,330 (GRCm39) E138K probably damaging Het
Cyp4a10 T C 4: 115,382,589 (GRCm39) I293T probably damaging Het
Dclk2 G A 3: 86,827,342 (GRCm39) P46S probably damaging Het
Dctn1 C T 6: 83,166,938 (GRCm39) T263I probably damaging Het
Ddx49 A T 8: 70,748,094 (GRCm39) V317E probably damaging Het
Edil3 G A 13: 89,093,072 (GRCm39) probably null Het
Egflam A T 15: 7,267,285 (GRCm39) V700E possibly damaging Het
Gigyf2 T G 1: 87,301,835 (GRCm39) probably null Het
H1f2 C G 13: 23,923,392 (GRCm39) S187R probably benign Het
Heatr4 A G 12: 84,026,514 (GRCm39) S248P probably benign Het
Hoxd1 A T 2: 74,594,524 (GRCm39) I260F possibly damaging Het
Hsd3b3 A T 3: 98,649,408 (GRCm39) L305Q probably damaging Het
Itch T A 2: 155,052,379 (GRCm39) C660S possibly damaging Het
Ivd A T 2: 118,701,981 (GRCm39) I138F probably benign Het
Katnip C G 7: 125,459,738 (GRCm39) H1189D probably damaging Het
Lcn4 G T 2: 26,561,228 (GRCm39) Q18K possibly damaging Het
Mapkbp1 T C 2: 119,843,146 (GRCm39) Y192H probably damaging Het
Mn1 T C 5: 111,566,723 (GRCm39) L231P probably damaging Het
Morc1 A G 16: 48,386,009 (GRCm39) D544G probably benign Het
Mthfd1 C A 12: 76,344,293 (GRCm39) T331K probably damaging Het
Myo18b T A 5: 113,021,423 (GRCm39) Y546F probably benign Het
Nod1 T C 6: 54,916,310 (GRCm39) Y129C probably damaging Het
Nprl3 A G 11: 32,182,973 (GRCm39) V563A probably damaging Het
Or13a18 T C 7: 140,190,498 (GRCm39) Y140H probably damaging Het
Or4a80 A T 2: 89,582,417 (GRCm39) C252S possibly damaging Het
Or5g29 A G 2: 85,421,766 (GRCm39) N294S probably damaging Het
Or5p72 T C 7: 108,022,389 (GRCm39) F204L probably benign Het
Or8b1b T C 9: 38,375,537 (GRCm39) S67P probably damaging Het
Orc3 T A 4: 34,611,049 (GRCm39) probably null Het
Otog T C 7: 45,913,498 (GRCm39) V777A probably benign Het
Pbxip1 G T 3: 89,356,020 (GRCm39) V711L probably benign Het
Pcdhb16 A G 18: 37,611,316 (GRCm39) D92G probably damaging Het
Phkb T A 8: 86,783,096 (GRCm39) M964K probably damaging Het
Pitpnm2 T A 5: 124,290,684 (GRCm39) M1L probably damaging Het
Pkhd1 A G 1: 20,269,683 (GRCm39) V3287A probably damaging Het
Polq T A 16: 36,882,844 (GRCm39) H1669Q probably damaging Het
Ppp4r4 T C 12: 103,552,016 (GRCm39) S195P probably damaging Het
Prdm2 T C 4: 142,861,517 (GRCm39) Y591C probably damaging Het
Rgsl1 T A 1: 153,701,651 (GRCm39) T268S possibly damaging Het
Scd2 A T 19: 44,291,610 (GRCm39) T350S probably benign Het
Scn7a T A 2: 66,518,091 (GRCm39) Q1040L possibly damaging Het
Sdhb T A 4: 140,706,340 (GRCm39) L259Q probably damaging Het
Senp6 A G 9: 80,033,680 (GRCm39) H701R probably damaging Het
Slc41a2 C T 10: 83,140,167 (GRCm39) probably null Het
Slx4 T C 16: 3,797,785 (GRCm39) D1533G probably damaging Het
Spef2 T C 15: 9,713,271 (GRCm39) K367R possibly damaging Het
Sstr3 G A 15: 78,424,711 (GRCm39) T12M probably benign Het
Synj2 G T 17: 6,047,221 (GRCm39) E20D probably damaging Het
Tchh G T 3: 93,353,281 (GRCm39) R907L unknown Het
Thsd1 A G 8: 22,749,247 (GRCm39) E645G probably benign Het
Tmem176b A T 6: 48,812,383 (GRCm39) M194K probably damaging Het
Tmprss11f T C 5: 86,739,265 (GRCm39) probably null Het
Trim44 G A 2: 102,230,722 (GRCm39) probably benign Het
Triml1 T A 8: 43,583,642 (GRCm39) R320W probably damaging Het
Trmt6 A T 2: 132,648,829 (GRCm39) C401* probably null Het
Trpv5 T C 6: 41,636,662 (GRCm39) probably null Het
V1rd19 T A 7: 23,702,726 (GRCm39) L64* probably null Het
Vmn1r216 A T 13: 23,283,661 (GRCm39) R115W probably damaging Het
Vmn2r58 T C 7: 41,509,924 (GRCm39) N551S probably damaging Het
Vmn2r77 T C 7: 86,450,921 (GRCm39) V269A probably benign Het
Vps13d A T 4: 144,881,813 (GRCm39) V1254D probably benign Het
Xpr1 T C 1: 155,156,775 (GRCm39) probably null Het
Zan T A 5: 137,450,712 (GRCm39) T1622S unknown Het
Zfp112 T C 7: 23,826,176 (GRCm39) Y715H probably damaging Het
Zfp750 G A 11: 121,403,951 (GRCm39) P308L possibly damaging Het
Other mutations in Fam168b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Fam168b APN 1 34,875,883 (GRCm39) start codon destroyed probably null 0.58
R0207:Fam168b UTSW 1 34,858,769 (GRCm39) missense probably damaging 0.98
R4020:Fam168b UTSW 1 34,867,860 (GRCm39) missense possibly damaging 0.71
R4617:Fam168b UTSW 1 34,859,063 (GRCm39) missense possibly damaging 0.90
R5154:Fam168b UTSW 1 34,857,180 (GRCm39) missense possibly damaging 0.83
R6167:Fam168b UTSW 1 34,858,684 (GRCm39) missense probably damaging 1.00
R6600:Fam168b UTSW 1 34,875,822 (GRCm39) missense probably damaging 1.00
R6602:Fam168b UTSW 1 34,875,822 (GRCm39) missense probably damaging 1.00
R6603:Fam168b UTSW 1 34,875,822 (GRCm39) missense probably damaging 1.00
R6627:Fam168b UTSW 1 34,875,822 (GRCm39) missense probably damaging 1.00
R6628:Fam168b UTSW 1 34,875,822 (GRCm39) missense probably damaging 1.00
R6644:Fam168b UTSW 1 34,875,822 (GRCm39) missense probably damaging 1.00
R6692:Fam168b UTSW 1 34,875,822 (GRCm39) missense probably damaging 1.00
R6705:Fam168b UTSW 1 34,867,864 (GRCm39) missense probably damaging 0.98
R6985:Fam168b UTSW 1 34,858,789 (GRCm39) missense probably damaging 1.00
R7387:Fam168b UTSW 1 34,858,789 (GRCm39) missense probably damaging 1.00
R8992:Fam168b UTSW 1 34,858,862 (GRCm39) missense probably benign 0.00
Z1177:Fam168b UTSW 1 34,858,963 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGTTGCTGGCATGCCATTG -3'
(R):5'- TGGCTCCTCTCTGTAGAATCG -3'

Sequencing Primer
(F):5'- CATTGGGCTGCACCACC -3'
(R):5'- AGAATCGTCCTTGTCTGGC -3'
Posted On 2014-08-25