Incidental Mutation 'R2008:Rgsl1'
ID219132
Institutional Source Beutler Lab
Gene Symbol Rgsl1
Ensembl Gene ENSMUSG00000042641
Gene Nameregulator of G-protein signaling like 1
SynonymsRgsl2, 4930415K13Rik
MMRRC Submission 040017-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2008 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location153779381-153844142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 153825905 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 268 (T268S)
Ref Sequence ENSEMBL: ENSMUSP00000135642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124558] [ENSMUST00000185164]
Predicted Effect possibly damaging
Transcript: ENSMUST00000124558
AA Change: T268S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135642
Gene: ENSMUSG00000042641
AA Change: T268S

DomainStartEndE-ValueType
low complexity region 122 136 N/A INTRINSIC
low complexity region 242 254 N/A INTRINSIC
low complexity region 316 325 N/A INTRINSIC
Pfam:RGS 644 754 7.1e-12 PFAM
transmembrane domain 956 973 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134030
Predicted Effect probably benign
Transcript: ENSMUST00000184095
Predicted Effect probably benign
Transcript: ENSMUST00000185164
AA Change: T303S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000139340
Gene: ENSMUSG00000042641
AA Change: T303S

DomainStartEndE-ValueType
low complexity region 157 171 N/A INTRINSIC
low complexity region 277 289 N/A INTRINSIC
low complexity region 351 360 N/A INTRINSIC
Pfam:RGS 679 789 4.1e-11 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik C T 5: 98,737,702 T156I possibly damaging Het
1700061G19Rik A G 17: 56,886,478 N608S probably benign Het
2510039O18Rik T A 4: 147,941,577 C185S probably benign Het
Actl6b T A 5: 137,569,330 S409T probably damaging Het
Adgrf2 T C 17: 42,710,122 T604A probably damaging Het
Adprhl2 T A 4: 126,317,344 D260V probably benign Het
Akap9 A G 5: 3,960,131 E296G possibly damaging Het
Alg5 A G 3: 54,746,473 Y210C possibly damaging Het
Aoc1 T C 6: 48,905,897 W236R probably damaging Het
Atp11b A G 3: 35,855,122 D1155G probably damaging Het
Atp2c1 T A 9: 105,432,726 T551S probably benign Het
Atp7b A T 8: 22,027,980 C281S probably damaging Het
Bmp1 C T 14: 70,492,466 C466Y probably damaging Het
Cabin1 T C 10: 75,734,976 probably null Het
Capn9 T G 8: 124,591,685 C97G probably damaging Het
Cbfa2t3 A G 8: 122,643,293 V147A probably damaging Het
Ccdc83 T A 7: 90,244,141 Y136F probably damaging Het
Cdh6 C A 15: 13,051,476 R357L possibly damaging Het
Celf1 A T 2: 91,010,408 N367I probably damaging Het
Cep350 T C 1: 155,914,721 I1363V probably benign Het
Colec12 T A 18: 9,874,813 D696E probably benign Het
Ctbp1 C T 5: 33,250,986 E138K probably damaging Het
Cyp4a10 T C 4: 115,525,392 I293T probably damaging Het
D430042O09Rik C G 7: 125,860,566 H1189D probably damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dctn1 C T 6: 83,189,956 T263I probably damaging Het
Ddx49 A T 8: 70,295,444 V317E probably damaging Het
Edil3 G A 13: 88,944,953 probably null Het
Egflam A T 15: 7,237,804 V700E possibly damaging Het
Fam168b A G 1: 34,819,865 probably null Het
Gigyf2 T G 1: 87,374,113 probably null Het
Gm5346 A T 8: 43,627,037 V50D probably benign Het
Heatr4 A G 12: 83,979,740 S248P probably benign Het
Hist1h1c C G 13: 23,739,409 S187R probably benign Het
Hoxd1 A T 2: 74,764,180 I260F possibly damaging Het
Hsd3b3 A T 3: 98,742,092 L305Q probably damaging Het
Itch T A 2: 155,210,459 C660S possibly damaging Het
Ivd A T 2: 118,871,500 I138F probably benign Het
Lcn4 G T 2: 26,671,216 Q18K possibly damaging Het
Mapkbp1 T C 2: 120,012,665 Y192H probably damaging Het
Mn1 T C 5: 111,418,857 L231P probably damaging Het
Morc1 A G 16: 48,565,646 D544G probably benign Het
Mthfd1 C A 12: 76,297,519 T331K probably damaging Het
Myo18b T A 5: 112,873,557 Y546F probably benign Het
Nod1 T C 6: 54,939,325 Y129C probably damaging Het
Nprl3 A G 11: 32,232,973 V563A probably damaging Het
Olfr1253 A T 2: 89,752,073 C252S possibly damaging Het
Olfr46 T C 7: 140,610,585 Y140H probably damaging Het
Olfr497 T C 7: 108,423,182 F204L probably benign Het
Olfr904 T C 9: 38,464,241 S67P probably damaging Het
Olfr998 A G 2: 85,591,422 N294S probably damaging Het
Orc3 T A 4: 34,611,049 probably null Het
Otog T C 7: 46,264,074 V777A probably benign Het
Pbxip1 G T 3: 89,448,713 V711L probably benign Het
Pcdhb16 A G 18: 37,478,263 D92G probably damaging Het
Phkb T A 8: 86,056,467 M964K probably damaging Het
Pitpnm2 T A 5: 124,152,621 M1L probably damaging Het
Pkhd1 A G 1: 20,199,459 V3287A probably damaging Het
Polq T A 16: 37,062,482 H1669Q probably damaging Het
Ppp4r4 T C 12: 103,585,757 S195P probably damaging Het
Prdm2 T C 4: 143,134,947 Y591C probably damaging Het
Scd2 A T 19: 44,303,171 T350S probably benign Het
Scn7a T A 2: 66,687,747 Q1040L possibly damaging Het
Sdhb T A 4: 140,979,029 L259Q probably damaging Het
Senp6 A G 9: 80,126,398 H701R probably damaging Het
Slc41a2 C T 10: 83,304,303 probably null Het
Slx4 T C 16: 3,979,921 D1533G probably damaging Het
Spef2 T C 15: 9,713,185 K367R possibly damaging Het
Sstr3 G A 15: 78,540,511 T12M probably benign Het
Synj2 G T 17: 5,996,946 E20D probably damaging Het
Tchh G T 3: 93,445,974 R907L unknown Het
Thsd1 A G 8: 22,259,231 E645G probably benign Het
Tmem176b A T 6: 48,835,449 M194K probably damaging Het
Tmprss11f T C 5: 86,591,406 probably null Het
Trim44 G A 2: 102,400,377 probably benign Het
Triml1 T A 8: 43,130,605 R320W probably damaging Het
Trmt6 A T 2: 132,806,909 C401* probably null Het
Trpv5 T C 6: 41,659,728 probably null Het
V1rd19 T A 7: 24,003,301 L64* probably null Het
Vmn1r216 A T 13: 23,099,491 R115W probably damaging Het
Vmn2r58 T C 7: 41,860,500 N551S probably damaging Het
Vmn2r77 T C 7: 86,801,713 V269A probably benign Het
Vps13d A T 4: 145,155,243 V1254D probably benign Het
Xpr1 T C 1: 155,281,029 probably null Het
Zan T A 5: 137,452,450 T1622S unknown Het
Zfp112 T C 7: 24,126,751 Y715H probably damaging Het
Zfp750 G A 11: 121,513,125 P308L possibly damaging Het
Other mutations in Rgsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01372:Rgsl1 APN 1 153826141 missense probably damaging 1.00
IGL02253:Rgsl1 APN 1 153793767 missense probably damaging 1.00
IGL02345:Rgsl1 APN 1 153804009 splice site probably null
IGL02409:Rgsl1 APN 1 153826243 missense possibly damaging 0.53
IGL02587:Rgsl1 APN 1 153799938 missense probably damaging 1.00
IGL02652:Rgsl1 APN 1 153825490 missense probably damaging 1.00
IGL02797:Rgsl1 APN 1 153807708 missense probably damaging 1.00
IGL03032:Rgsl1 APN 1 153826202 missense possibly damaging 0.53
IGL03082:Rgsl1 APN 1 153799947 missense possibly damaging 0.86
IGL03123:Rgsl1 APN 1 153825941 missense probably damaging 1.00
IGL03213:Rgsl1 APN 1 153825841 missense probably benign 0.12
IGL03410:Rgsl1 APN 1 153793755 missense probably null 0.82
IGL03050:Rgsl1 UTSW 1 153825676 missense possibly damaging 0.60
PIT4519001:Rgsl1 UTSW 1 153825970 missense possibly damaging 0.96
R0149:Rgsl1 UTSW 1 153793764 missense probably damaging 1.00
R0536:Rgsl1 UTSW 1 153826181 missense probably damaging 1.00
R0633:Rgsl1 UTSW 1 153844107 missense possibly damaging 0.72
R0726:Rgsl1 UTSW 1 153802328 missense probably damaging 1.00
R0839:Rgsl1 UTSW 1 153802234 critical splice donor site probably null
R1240:Rgsl1 UTSW 1 153785191 missense probably benign 0.18
R1355:Rgsl1 UTSW 1 153807761 start codon destroyed probably null 0.23
R1491:Rgsl1 UTSW 1 153825926 missense possibly damaging 0.93
R1688:Rgsl1 UTSW 1 153804676 missense probably damaging 0.98
R1694:Rgsl1 UTSW 1 153804676 missense probably damaging 0.98
R1842:Rgsl1 UTSW 1 153799797 missense probably damaging 1.00
R2114:Rgsl1 UTSW 1 153817549 missense probably benign
R2116:Rgsl1 UTSW 1 153817549 missense probably benign
R2176:Rgsl1 UTSW 1 153825268 splice site probably benign
R2229:Rgsl1 UTSW 1 153822358 missense possibly damaging 0.72
R2895:Rgsl1 UTSW 1 153827548 missense probably damaging 1.00
R3923:Rgsl1 UTSW 1 153804130 critical splice acceptor site probably null
R4001:Rgsl1 UTSW 1 153817584 missense probably damaging 1.00
R4434:Rgsl1 UTSW 1 153802341 missense possibly damaging 0.52
R4489:Rgsl1 UTSW 1 153827536 missense probably benign 0.27
R4649:Rgsl1 UTSW 1 153817582 missense probably benign 0.01
R4925:Rgsl1 UTSW 1 153812277 missense probably benign 0.01
R4928:Rgsl1 UTSW 1 153793768 missense probably damaging 1.00
R5045:Rgsl1 UTSW 1 153821522 nonsense probably null
R5304:Rgsl1 UTSW 1 153827492 missense probably damaging 0.97
R5331:Rgsl1 UTSW 1 153802292 missense probably benign 0.02
R5373:Rgsl1 UTSW 1 153790307 missense probably benign 0.33
R5374:Rgsl1 UTSW 1 153790307 missense probably benign 0.33
R5566:Rgsl1 UTSW 1 153793774 missense probably damaging 1.00
R5649:Rgsl1 UTSW 1 153825893 missense possibly damaging 0.93
R6062:Rgsl1 UTSW 1 153799872 missense possibly damaging 0.72
R6142:Rgsl1 UTSW 1 153812238 missense probably benign 0.01
R6158:Rgsl1 UTSW 1 153804021 missense possibly damaging 0.72
R6184:Rgsl1 UTSW 1 153827448 missense probably benign 0.08
R6273:Rgsl1 UTSW 1 153827465 missense possibly damaging 0.96
R6384:Rgsl1 UTSW 1 153827545 missense possibly damaging 0.86
R6419:Rgsl1 UTSW 1 153822371 missense probably damaging 0.98
R6568:Rgsl1 UTSW 1 153821546 missense possibly damaging 0.72
R6660:Rgsl1 UTSW 1 153825766 missense possibly damaging 0.70
R6745:Rgsl1 UTSW 1 153822317 missense probably benign 0.18
R6892:Rgsl1 UTSW 1 153821499 nonsense probably null
R6974:Rgsl1 UTSW 1 153799822 missense probably damaging 1.00
R7172:Rgsl1 UTSW 1 153826220 missense possibly damaging 0.72
R7200:Rgsl1 UTSW 1 153785199 missense probably benign 0.33
R7275:Rgsl1 UTSW 1 153804130 critical splice acceptor site probably null
R7313:Rgsl1 UTSW 1 153807876 critical splice acceptor site probably null
R7341:Rgsl1 UTSW 1 153793845 missense probably benign 0.01
R7448:Rgsl1 UTSW 1 153844101 critical splice donor site probably null
R7662:Rgsl1 UTSW 1 153825479 missense probably benign
R7703:Rgsl1 UTSW 1 153793864 missense possibly damaging 0.73
R7846:Rgsl1 UTSW 1 153826037 missense possibly damaging 0.53
X0020:Rgsl1 UTSW 1 153825385 missense probably benign 0.33
X0065:Rgsl1 UTSW 1 153804033 missense possibly damaging 0.84
Z1177:Rgsl1 UTSW 1 153817610 missense possibly damaging 0.70
Z1177:Rgsl1 UTSW 1 153825988 missense not run
Predicted Primers PCR Primer
(F):5'- AGTGAACGCTGTCTCAAGGAAG -3'
(R):5'- AGCATGCCATGGTCTGATGC -3'

Sequencing Primer
(F):5'- TGTCTCAAGGAAGCCCTCC -3'
(R):5'- CAGGAATATGAGACTCGCCTGTAC -3'
Posted On2014-08-25