Incidental Mutation 'R0135:Brwd1'
ID21914
Institutional Source Beutler Lab
Gene Symbol Brwd1
Ensembl Gene ENSMUSG00000022914
Gene Namebromodomain and WD repeat domain containing 1
SynonymsG1-403-16, repro5, D530019K20Rik, 5330419I02Rik, Wdr9
MMRRC Submission 038420-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0135 (G1)
Quality Score225
Status Validated (trace)
Chromosome16
Chromosomal Location95992092-96082428 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 96047104 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 572 (N572K)
Ref Sequence ENSEMBL: ENSMUSP00000097101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023631] [ENSMUST00000099502] [ENSMUST00000113829] [ENSMUST00000124370] [ENSMUST00000131322] [ENSMUST00000153398]
Predicted Effect probably damaging
Transcript: ENSMUST00000023631
AA Change: N572K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023631
Gene: ENSMUSG00000022914
AA Change: N572K

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
low complexity region 1497 1513 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
internal_repeat_1 1574 1762 1.42e-9 PROSPERO
low complexity region 1764 1775 N/A INTRINSIC
internal_repeat_1 1857 2050 1.42e-9 PROSPERO
low complexity region 2165 2174 N/A INTRINSIC
low complexity region 2260 2270 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099502
AA Change: N572K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097101
Gene: ENSMUSG00000022914
AA Change: N572K

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
low complexity region 1497 1513 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
internal_repeat_1 1574 1762 1.42e-9 PROSPERO
low complexity region 1764 1775 N/A INTRINSIC
internal_repeat_1 1857 2050 1.42e-9 PROSPERO
low complexity region 2165 2174 N/A INTRINSIC
low complexity region 2260 2270 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113829
AA Change: N572K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109460
Gene: ENSMUSG00000022914
AA Change: N572K

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
low complexity region 1497 1513 N/A INTRINSIC
low complexity region 1543 1558 N/A INTRINSIC
internal_repeat_1 1574 1762 1.13e-9 PROSPERO
low complexity region 1764 1775 N/A INTRINSIC
internal_repeat_1 1857 2050 1.13e-9 PROSPERO
low complexity region 2165 2174 N/A INTRINSIC
low complexity region 2177 2188 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000124370
AA Change: N295K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118423
Gene: ENSMUSG00000022914
AA Change: N295K

DomainStartEndE-ValueType
WD40 34 75 3.82e1 SMART
WD40 80 119 4.27e-8 SMART
WD40 140 177 8.59e-1 SMART
WD40 180 220 1.47e-6 SMART
WD40 227 267 9.21e0 SMART
low complexity region 383 399 N/A INTRINSIC
low complexity region 476 490 N/A INTRINSIC
low complexity region 531 547 N/A INTRINSIC
low complexity region 585 602 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126629
Predicted Effect probably damaging
Transcript: ENSMUST00000131322
AA Change: N19K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118327
Gene: ENSMUSG00000022914
AA Change: N19K

DomainStartEndE-ValueType
low complexity region 107 123 N/A INTRINSIC
low complexity region 200 214 N/A INTRINSIC
low complexity region 299 315 N/A INTRINSIC
low complexity region 353 374 N/A INTRINSIC
Blast:BROMO 496 582 4e-37 BLAST
Blast:BROMO 603 627 5e-8 BLAST
Predicted Effect
SMART Domains Protein: ENSMUSP00000121141
Gene: ENSMUSG00000022914
AA Change: N283K

DomainStartEndE-ValueType
WD40 23 64 3.82e1 SMART
WD40 69 108 4.27e-8 SMART
WD40 129 166 8.59e-1 SMART
WD40 169 209 1.47e-6 SMART
WD40 216 256 9.21e0 SMART
low complexity region 372 388 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153398
AA Change: N572K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117066
Gene: ENSMUSG00000022914
AA Change: N572K

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
WD40 175 214 1.3e-7 SMART
WD40 217 256 2.26e-7 SMART
WD40 259 302 1.83e-7 SMART
WD40 311 352 3.82e1 SMART
WD40 357 396 4.27e-8 SMART
WD40 417 454 8.59e-1 SMART
WD40 457 497 1.47e-6 SMART
WD40 504 544 9.21e0 SMART
low complexity region 660 676 N/A INTRINSIC
low complexity region 753 767 N/A INTRINSIC
low complexity region 852 868 N/A INTRINSIC
low complexity region 906 927 N/A INTRINSIC
BROMO 1156 1267 1.72e-6 SMART
low complexity region 1277 1292 N/A INTRINSIC
BROMO 1317 1422 2.65e-30 SMART
internal_repeat_1 1491 1957 1.45e-251 PROSPERO
internal_repeat_1 1956 2422 1.45e-251 PROSPERO
low complexity region 2630 2639 N/A INTRINSIC
Meta Mutation Damage Score 0.1943 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.6%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) residues which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes including cell cycle progression, signal transduction, apoptosis, and gene regulation. This protein contains 2 bromodomains and multiple WD repeats. This gene is located within the Down syndrome region-2 on chromosome 21. Alternative splicing of this gene generates multiple transcript variants encoding distinct isoforms. In mouse, this gene encodes a nuclear protein that has a polyglutamine-containing region that functions as a transcriptional activation domain which may regulate chromatin remodelling and associates with a component of the SWI/SNF chromatin remodelling complex.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous males and females are infertile. Spermiogenesis is impaired; males have low epididymal sperm concentration with low motility and abnormal sperm head morphology. Female oocytes commonly contain vacuoles and have low developmental competence to 2-cell and blastocyst stages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik T C 7: 34,245,957 I499M probably damaging Het
4932438H23Rik A G 16: 91,055,627 F207S probably damaging Het
Abhd8 T A 8: 71,458,074 K363N probably benign Het
Adam11 T A 11: 102,776,573 V653E probably damaging Het
Adam18 T C 8: 24,665,542 S154G possibly damaging Het
Adamts1 T C 16: 85,798,703 probably benign Het
Afm G T 5: 90,550,322 V528L probably benign Het
Alox12b C T 11: 69,162,748 H145Y probably benign Het
Ankmy2 C A 12: 36,170,435 probably benign Het
Aox3 G A 1: 58,125,088 probably benign Het
Arhgap28 T C 17: 67,864,588 D396G probably damaging Het
B430203G13Rik T C 12: 17,924,488 noncoding transcript Het
Bean1 C T 8: 104,217,175 P121S probably damaging Het
Bok T C 1: 93,686,507 S21P probably damaging Het
C5ar1 A T 7: 16,248,939 V52E probably damaging Het
Cdr2l C A 11: 115,393,671 P278T probably damaging Het
Cnga4 T A 7: 105,406,848 I219N probably damaging Het
Cpne2 C T 8: 94,554,925 probably benign Het
D430041D05Rik A G 2: 104,255,034 S1057P possibly damaging Het
Def8 G A 8: 123,456,495 A278T probably damaging Het
Dgcr2 A G 16: 17,858,442 S152P probably damaging Het
Dstyk A T 1: 132,462,934 D828V probably damaging Het
Eml2 T C 7: 19,203,952 S582P probably damaging Het
Engase T C 11: 118,484,478 Y359H possibly damaging Het
Fat3 T C 9: 16,006,777 D1450G probably damaging Het
Fbxw8 A T 5: 118,070,487 I467N probably damaging Het
Fhdc1 A T 3: 84,445,618 Y767N probably damaging Het
Flii T C 11: 60,723,378 D105G probably damaging Het
Gaa C T 11: 119,278,890 T590I probably benign Het
Gabrr1 T A 4: 33,160,224 S303T probably damaging Het
Gif G T 19: 11,757,754 C246F probably damaging Het
Glp1r A G 17: 30,924,577 I196V probably benign Het
Gm884 C A 11: 103,618,047 probably benign Het
Grm6 G A 11: 50,853,223 E174K probably damaging Het
Helz2 A C 2: 181,232,269 L2144R probably damaging Het
Itpr1 A T 6: 108,488,482 probably benign Het
Kcns1 A T 2: 164,164,955 S363T possibly damaging Het
Kif13a A T 13: 46,793,943 V855E probably damaging Het
Krt42 T C 11: 100,263,159 T424A possibly damaging Het
Lct A T 1: 128,285,123 F1931Y probably damaging Het
Lrp1b A T 2: 41,269,239 V1563E probably damaging Het
Lzts2 T C 19: 45,026,187 probably benign Het
Mamdc4 C T 2: 25,566,920 R615Q possibly damaging Het
Mei1 C T 15: 82,071,969 Q133* probably null Het
Mif4gd T C 11: 115,608,465 E197G probably damaging Het
Ncdn A T 4: 126,746,669 S544T probably benign Het
Nfat5 C T 8: 107,339,075 R156W probably damaging Het
Olfr68 T A 7: 103,777,763 D194V probably damaging Het
Padi6 T C 4: 140,737,352 T114A probably benign Het
Pigk G T 3: 152,744,706 probably benign Het
Pkd1 T A 17: 24,565,071 F197Y possibly damaging Het
Pld5 A T 1: 175,970,589 F415I probably damaging Het
Pnpla5 A G 15: 84,113,949 L364P probably damaging Het
Prrc2c G A 1: 162,715,483 probably benign Het
Rab32 C T 10: 10,550,840 D121N probably damaging Het
Rab44 A T 17: 29,138,132 T79S probably benign Het
Reln G T 5: 22,128,649 N258K probably damaging Het
Retsat A G 6: 72,602,772 T177A probably damaging Het
Serpinf2 T A 11: 75,436,393 H236L probably damaging Het
Slc26a6 A T 9: 108,860,595 probably benign Het
Slitrk1 T A 14: 108,911,629 E550V probably benign Het
Smarcd3 A T 5: 24,595,499 probably benign Het
Spdye4a A C 5: 143,225,102 probably null Het
Susd2 C T 10: 75,638,514 G572D probably damaging Het
Tcaf3 C T 6: 42,589,758 R799K probably benign Het
Tg A G 15: 66,694,870 S1256G probably benign Het
Them4 A T 3: 94,323,570 probably benign Het
Tmem210 C T 2: 25,288,468 A47V probably damaging Het
Tnfrsf1b A G 4: 145,229,046 Y47H probably benign Het
Tnik T G 3: 28,607,245 N598K possibly damaging Het
Ttc3 A G 16: 94,462,268 N1498D possibly damaging Het
Ttll4 C A 1: 74,679,928 H313N possibly damaging Het
Vipr2 A G 12: 116,142,827 I348V probably benign Het
Vps13a A G 19: 16,780,765 V2A probably damaging Het
Vps72 G A 3: 95,119,197 R151K probably damaging Het
Zfp106 A G 2: 120,520,487 V1561A probably damaging Het
Zfp658 C A 7: 43,573,595 Y431* probably null Het
Zkscan2 T C 7: 123,480,641 K698E possibly damaging Het
Other mutations in Brwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00690:Brwd1 APN 16 96017586 missense probably damaging 1.00
IGL00974:Brwd1 APN 16 96043026 missense probably damaging 1.00
IGL01014:Brwd1 APN 16 96016173 missense probably benign 0.04
IGL01447:Brwd1 APN 16 96047379 nonsense probably null
IGL01459:Brwd1 APN 16 96047420 missense probably damaging 1.00
IGL01631:Brwd1 APN 16 96046466 missense probably damaging 1.00
IGL02184:Brwd1 APN 16 96013829 missense probably damaging 1.00
IGL02264:Brwd1 APN 16 96019456 missense probably damaging 0.98
IGL02679:Brwd1 APN 16 96002823 missense probably benign
IGL02833:Brwd1 APN 16 96052571 missense probably damaging 1.00
IGL02960:Brwd1 APN 16 96057466 missense probably damaging 1.00
IGL03053:Brwd1 APN 16 96017677 missense possibly damaging 0.75
IGL03074:Brwd1 APN 16 96011850 missense probably benign 0.00
IGL03135:Brwd1 APN 16 96021258 missense probably damaging 0.99
IGL03168:Brwd1 APN 16 96017677 missense possibly damaging 0.75
IGL03214:Brwd1 APN 16 96037900 missense probably benign 0.26
IGL03328:Brwd1 APN 16 96002725 missense probably damaging 0.99
Embers UTSW 16 96017604 missense probably damaging 1.00
Glowing UTSW 16 96035959 missense probably damaging 1.00
PIT4243001:Brwd1 UTSW 16 96002671 nonsense probably null
R0012:Brwd1 UTSW 16 96059652 missense probably damaging 0.98
R0012:Brwd1 UTSW 16 96059652 missense probably damaging 0.98
R0030:Brwd1 UTSW 16 96021256 missense probably damaging 1.00
R0366:Brwd1 UTSW 16 96037964 nonsense probably null
R0551:Brwd1 UTSW 16 96035974 missense probably damaging 1.00
R0586:Brwd1 UTSW 16 96043086 missense probably damaging 1.00
R0865:Brwd1 UTSW 16 96068584 missense probably damaging 1.00
R1226:Brwd1 UTSW 16 96031548 missense probably benign 0.35
R1329:Brwd1 UTSW 16 96003234 missense probably benign 0.07
R1378:Brwd1 UTSW 16 96041370 missense probably benign 0.06
R1420:Brwd1 UTSW 16 96036034 missense probably damaging 1.00
R1441:Brwd1 UTSW 16 96066151 missense probably damaging 0.99
R1484:Brwd1 UTSW 16 96028291 unclassified probably null
R1624:Brwd1 UTSW 16 96008144 missense possibly damaging 0.67
R1636:Brwd1 UTSW 16 96059641 missense probably damaging 1.00
R1988:Brwd1 UTSW 16 96021237 missense probably damaging 0.96
R1998:Brwd1 UTSW 16 96021288 missense probably damaging 1.00
R2066:Brwd1 UTSW 16 96046465 missense probably benign 0.01
R2898:Brwd1 UTSW 16 96066100 missense probably damaging 0.99
R2983:Brwd1 UTSW 16 96066574 missense probably damaging 0.98
R3966:Brwd1 UTSW 16 96044530 missense probably damaging 1.00
R4086:Brwd1 UTSW 16 96046372 missense probably benign 0.03
R4257:Brwd1 UTSW 16 96023496 missense probably damaging 1.00
R4290:Brwd1 UTSW 16 96017604 missense probably damaging 1.00
R4292:Brwd1 UTSW 16 96017604 missense probably damaging 1.00
R4293:Brwd1 UTSW 16 96017604 missense probably damaging 1.00
R4614:Brwd1 UTSW 16 96047359 missense probably damaging 1.00
R4771:Brwd1 UTSW 16 96003318 missense probably benign 0.00
R5025:Brwd1 UTSW 16 96053972 missense probably damaging 0.97
R5155:Brwd1 UTSW 16 96002793 nonsense probably null
R5229:Brwd1 UTSW 16 96002209 missense possibly damaging 0.87
R5246:Brwd1 UTSW 16 96002557 missense probably damaging 1.00
R5668:Brwd1 UTSW 16 96016150 missense probably damaging 1.00
R5763:Brwd1 UTSW 16 96033843 nonsense probably null
R5782:Brwd1 UTSW 16 96043043 nonsense probably null
R5831:Brwd1 UTSW 16 96019436 missense probably damaging 1.00
R5836:Brwd1 UTSW 16 96064758 missense probably damaging 1.00
R5906:Brwd1 UTSW 16 96058738 missense probably damaging 1.00
R5995:Brwd1 UTSW 16 96064787 missense probably damaging 1.00
R6143:Brwd1 UTSW 16 96002956 missense probably benign 0.00
R6241:Brwd1 UTSW 16 96013874 missense probably damaging 1.00
R6313:Brwd1 UTSW 16 96007941 missense probably benign 0.01
R6362:Brwd1 UTSW 16 96002307 missense probably damaging 1.00
R6551:Brwd1 UTSW 16 95993962 missense possibly damaging 0.55
R6736:Brwd1 UTSW 16 96068572 missense probably damaging 1.00
R6822:Brwd1 UTSW 16 96041274 missense probably benign 0.42
R7080:Brwd1 UTSW 16 96009530 missense probably benign 0.01
R7131:Brwd1 UTSW 16 96066498 missense probably damaging 1.00
R7208:Brwd1 UTSW 16 96035959 missense probably damaging 1.00
R7322:Brwd1 UTSW 16 96066119 missense probably damaging 1.00
R7483:Brwd1 UTSW 16 96056173 missense probably damaging 0.99
R7615:Brwd1 UTSW 16 96033839 missense probably damaging 0.96
R7621:Brwd1 UTSW 16 96064887 missense probably damaging 1.00
R7665:Brwd1 UTSW 16 96041343 missense probably benign 0.09
R7697:Brwd1 UTSW 16 96046401 missense probably benign 0.10
R7740:Brwd1 UTSW 16 96027368 missense probably damaging 1.00
X0017:Brwd1 UTSW 16 96044491 missense probably damaging 1.00
X0028:Brwd1 UTSW 16 96011923 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- AGCCAGCCTATTCTACACAGGGAG -3'
(R):5'- GGCAGGTGGTCATACACATAGAGC -3'

Sequencing Primer
(F):5'- agggagttacaggaaaaccag -3'
(R):5'- CTGCAAGTTTTCACAGGATGGAC -3'
Posted On2013-04-12