Incidental Mutation 'R2008:Prdm2'
ID219187
Institutional Source Beutler Lab
Gene Symbol Prdm2
Ensembl Gene ENSMUSG00000057637
Gene NamePR domain containing 2, with ZNF domain
SynonymsKMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik
MMRRC Submission 040017-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2008 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location143107391-143212995 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143134947 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 591 (Y591C)
Ref Sequence ENSEMBL: ENSMUSP00000101404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105778]
Predicted Effect probably damaging
Transcript: ENSMUST00000105778
AA Change: Y591C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: Y591C

DomainStartEndE-ValueType
SET 29 146 2.79e-21 SMART
coiled coil region 254 293 N/A INTRINSIC
low complexity region 333 346 N/A INTRINSIC
ZnF_C2H2 356 378 2.95e-3 SMART
ZnF_C2H2 386 408 4.79e-3 SMART
ZnF_C2H2 477 500 4.17e-3 SMART
low complexity region 517 528 N/A INTRINSIC
low complexity region 653 669 N/A INTRINSIC
low complexity region 682 697 N/A INTRINSIC
low complexity region 726 744 N/A INTRINSIC
low complexity region 868 877 N/A INTRINSIC
low complexity region 931 951 N/A INTRINSIC
low complexity region 954 992 N/A INTRINSIC
low complexity region 1011 1032 N/A INTRINSIC
low complexity region 1035 1080 N/A INTRINSIC
ZnF_C2H2 1126 1148 3.52e-1 SMART
ZnF_C2H2 1154 1177 7.55e-1 SMART
ZnF_C2H2 1183 1206 4.72e-2 SMART
low complexity region 1239 1253 N/A INTRINSIC
ZnF_C2H2 1324 1344 5.12e1 SMART
low complexity region 1406 1423 N/A INTRINSIC
ZnF_C2H2 1446 1466 1.86e1 SMART
low complexity region 1475 1507 N/A INTRINSIC
low complexity region 1551 1568 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197026
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik C T 5: 98,737,702 T156I possibly damaging Het
1700061G19Rik A G 17: 56,886,478 N608S probably benign Het
2510039O18Rik T A 4: 147,941,577 C185S probably benign Het
Actl6b T A 5: 137,569,330 S409T probably damaging Het
Adgrf2 T C 17: 42,710,122 T604A probably damaging Het
Adprhl2 T A 4: 126,317,344 D260V probably benign Het
Akap9 A G 5: 3,960,131 E296G possibly damaging Het
Alg5 A G 3: 54,746,473 Y210C possibly damaging Het
Aoc1 T C 6: 48,905,897 W236R probably damaging Het
Atp11b A G 3: 35,855,122 D1155G probably damaging Het
Atp2c1 T A 9: 105,432,726 T551S probably benign Het
Atp7b A T 8: 22,027,980 C281S probably damaging Het
Bmp1 C T 14: 70,492,466 C466Y probably damaging Het
Cabin1 T C 10: 75,734,976 probably null Het
Capn9 T G 8: 124,591,685 C97G probably damaging Het
Cbfa2t3 A G 8: 122,643,293 V147A probably damaging Het
Ccdc83 T A 7: 90,244,141 Y136F probably damaging Het
Cdh6 C A 15: 13,051,476 R357L possibly damaging Het
Celf1 A T 2: 91,010,408 N367I probably damaging Het
Cep350 T C 1: 155,914,721 I1363V probably benign Het
Colec12 T A 18: 9,874,813 D696E probably benign Het
Ctbp1 C T 5: 33,250,986 E138K probably damaging Het
Cyp4a10 T C 4: 115,525,392 I293T probably damaging Het
D430042O09Rik C G 7: 125,860,566 H1189D probably damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dctn1 C T 6: 83,189,956 T263I probably damaging Het
Ddx49 A T 8: 70,295,444 V317E probably damaging Het
Edil3 G A 13: 88,944,953 probably null Het
Egflam A T 15: 7,237,804 V700E possibly damaging Het
Fam168b A G 1: 34,819,865 probably null Het
Gigyf2 T G 1: 87,374,113 probably null Het
Gm5346 A T 8: 43,627,037 V50D probably benign Het
Heatr4 A G 12: 83,979,740 S248P probably benign Het
Hist1h1c C G 13: 23,739,409 S187R probably benign Het
Hoxd1 A T 2: 74,764,180 I260F possibly damaging Het
Hsd3b3 A T 3: 98,742,092 L305Q probably damaging Het
Itch T A 2: 155,210,459 C660S possibly damaging Het
Ivd A T 2: 118,871,500 I138F probably benign Het
Lcn4 G T 2: 26,671,216 Q18K possibly damaging Het
Mapkbp1 T C 2: 120,012,665 Y192H probably damaging Het
Mn1 T C 5: 111,418,857 L231P probably damaging Het
Morc1 A G 16: 48,565,646 D544G probably benign Het
Mthfd1 C A 12: 76,297,519 T331K probably damaging Het
Myo18b T A 5: 112,873,557 Y546F probably benign Het
Nod1 T C 6: 54,939,325 Y129C probably damaging Het
Nprl3 A G 11: 32,232,973 V563A probably damaging Het
Olfr1253 A T 2: 89,752,073 C252S possibly damaging Het
Olfr46 T C 7: 140,610,585 Y140H probably damaging Het
Olfr497 T C 7: 108,423,182 F204L probably benign Het
Olfr904 T C 9: 38,464,241 S67P probably damaging Het
Olfr998 A G 2: 85,591,422 N294S probably damaging Het
Orc3 T A 4: 34,611,049 probably null Het
Otog T C 7: 46,264,074 V777A probably benign Het
Pbxip1 G T 3: 89,448,713 V711L probably benign Het
Pcdhb16 A G 18: 37,478,263 D92G probably damaging Het
Phkb T A 8: 86,056,467 M964K probably damaging Het
Pitpnm2 T A 5: 124,152,621 M1L probably damaging Het
Pkhd1 A G 1: 20,199,459 V3287A probably damaging Het
Polq T A 16: 37,062,482 H1669Q probably damaging Het
Ppp4r4 T C 12: 103,585,757 S195P probably damaging Het
Rgsl1 T A 1: 153,825,905 T268S possibly damaging Het
Scd2 A T 19: 44,303,171 T350S probably benign Het
Scn7a T A 2: 66,687,747 Q1040L possibly damaging Het
Sdhb T A 4: 140,979,029 L259Q probably damaging Het
Senp6 A G 9: 80,126,398 H701R probably damaging Het
Slc41a2 C T 10: 83,304,303 probably null Het
Slx4 T C 16: 3,979,921 D1533G probably damaging Het
Spef2 T C 15: 9,713,185 K367R possibly damaging Het
Sstr3 G A 15: 78,540,511 T12M probably benign Het
Synj2 G T 17: 5,996,946 E20D probably damaging Het
Tchh G T 3: 93,445,974 R907L unknown Het
Thsd1 A G 8: 22,259,231 E645G probably benign Het
Tmem176b A T 6: 48,835,449 M194K probably damaging Het
Tmprss11f T C 5: 86,591,406 probably null Het
Trim44 G A 2: 102,400,377 probably benign Het
Triml1 T A 8: 43,130,605 R320W probably damaging Het
Trmt6 A T 2: 132,806,909 C401* probably null Het
Trpv5 T C 6: 41,659,728 probably null Het
V1rd19 T A 7: 24,003,301 L64* probably null Het
Vmn1r216 A T 13: 23,099,491 R115W probably damaging Het
Vmn2r58 T C 7: 41,860,500 N551S probably damaging Het
Vmn2r77 T C 7: 86,801,713 V269A probably benign Het
Vps13d A T 4: 145,155,243 V1254D probably benign Het
Xpr1 T C 1: 155,281,029 probably null Het
Zan T A 5: 137,452,450 T1622S unknown Het
Zfp112 T C 7: 24,126,751 Y715H probably damaging Het
Zfp750 G A 11: 121,513,125 P308L possibly damaging Het
Other mutations in Prdm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Prdm2 APN 4 143133759 missense probably damaging 0.99
IGL00843:Prdm2 APN 4 143134314 missense probably damaging 1.00
IGL01419:Prdm2 APN 4 143133648 missense probably damaging 0.99
IGL01662:Prdm2 APN 4 143133568 missense possibly damaging 0.73
IGL01892:Prdm2 APN 4 143134404 missense probably damaging 1.00
IGL02104:Prdm2 APN 4 143133427 missense probably benign 0.01
IGL02208:Prdm2 APN 4 143135743 missense probably benign 0.01
IGL02260:Prdm2 APN 4 143134587 missense probably damaging 1.00
IGL02479:Prdm2 APN 4 143134929 missense probably damaging 1.00
IGL02943:Prdm2 APN 4 143131972 missense probably benign
IGL02972:Prdm2 APN 4 143132166 missense probably benign
IGL03038:Prdm2 APN 4 143134001 missense probably damaging 1.00
IGL03399:Prdm2 APN 4 143135088 missense probably benign 0.07
G1patch:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
PIT4677001:Prdm2 UTSW 4 143135078 missense probably damaging 1.00
R0088:Prdm2 UTSW 4 143134954 missense possibly damaging 0.86
R0153:Prdm2 UTSW 4 143133768 missense possibly damaging 0.93
R0320:Prdm2 UTSW 4 143179351 missense probably damaging 1.00
R0384:Prdm2 UTSW 4 143135688 missense probably benign 0.01
R0400:Prdm2 UTSW 4 143111670 missense probably benign
R0658:Prdm2 UTSW 4 143135265 missense probably damaging 1.00
R0850:Prdm2 UTSW 4 143132203 missense possibly damaging 0.53
R1118:Prdm2 UTSW 4 143132383 missense possibly damaging 0.52
R1355:Prdm2 UTSW 4 143131963 missense probably benign 0.33
R1519:Prdm2 UTSW 4 143135583 missense probably damaging 1.00
R1936:Prdm2 UTSW 4 143134462 missense probably benign 0.00
R1987:Prdm2 UTSW 4 143132509 missense possibly damaging 0.73
R2006:Prdm2 UTSW 4 143131877 missense possibly damaging 0.73
R2030:Prdm2 UTSW 4 143132764 missense possibly damaging 0.53
R2112:Prdm2 UTSW 4 143131936 missense probably benign
R2221:Prdm2 UTSW 4 143134899 missense possibly damaging 0.58
R2223:Prdm2 UTSW 4 143134899 missense possibly damaging 0.58
R2426:Prdm2 UTSW 4 143111750 nonsense probably null
R2430:Prdm2 UTSW 4 143133163 missense possibly damaging 0.73
R2484:Prdm2 UTSW 4 143135206 missense probably damaging 1.00
R3735:Prdm2 UTSW 4 143134359 missense probably damaging 1.00
R3944:Prdm2 UTSW 4 143131815 missense possibly damaging 0.53
R4209:Prdm2 UTSW 4 143134437 missense probably damaging 1.00
R4411:Prdm2 UTSW 4 143133670 missense probably benign 0.18
R4647:Prdm2 UTSW 4 143132955 missense possibly damaging 0.85
R4898:Prdm2 UTSW 4 143134191 missense probably damaging 1.00
R5032:Prdm2 UTSW 4 143179367 nonsense probably null
R5181:Prdm2 UTSW 4 143134966 missense probably benign 0.35
R5513:Prdm2 UTSW 4 143135893 small deletion probably benign
R5539:Prdm2 UTSW 4 143132694 missense possibly damaging 0.53
R5563:Prdm2 UTSW 4 143134630 missense probably benign 0.09
R5618:Prdm2 UTSW 4 143133537 missense probably benign 0.00
R5900:Prdm2 UTSW 4 143134720 missense probably damaging 1.00
R5990:Prdm2 UTSW 4 143170113 missense probably damaging 1.00
R6148:Prdm2 UTSW 4 143132907 missense probably benign 0.33
R6166:Prdm2 UTSW 4 143134736 missense probably damaging 0.99
R6223:Prdm2 UTSW 4 143142207 missense probably benign 0.41
R6530:Prdm2 UTSW 4 143134047 missense probably benign 0.05
R6631:Prdm2 UTSW 4 143134884 missense probably benign 0.05
R6725:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
R6847:Prdm2 UTSW 4 143132950 missense probably benign 0.18
R7193:Prdm2 UTSW 4 143180894 missense probably damaging 1.00
R7238:Prdm2 UTSW 4 143135821 missense probably benign 0.35
R7292:Prdm2 UTSW 4 143132901 missense possibly damaging 0.96
R7417:Prdm2 UTSW 4 143179299 missense probably damaging 1.00
R7748:Prdm2 UTSW 4 143135889 missense possibly damaging 0.89
R7885:Prdm2 UTSW 4 143134570 missense probably benign 0.41
R7936:Prdm2 UTSW 4 143135864 missense probably damaging 0.99
R7976:Prdm2 UTSW 4 143133242 nonsense probably null
R8124:Prdm2 UTSW 4 143135265 missense probably damaging 1.00
R8150:Prdm2 UTSW 4 143132733 missense possibly damaging 0.73
R8156:Prdm2 UTSW 4 143134768 missense probably benign 0.01
R8178:Prdm2 UTSW 4 143132448 missense probably benign 0.33
R8235:Prdm2 UTSW 4 143132467 nonsense probably null
R8404:Prdm2 UTSW 4 143135014 missense probably damaging 0.98
R8498:Prdm2 UTSW 4 143180897 missense probably damaging 1.00
R8502:Prdm2 UTSW 4 143135014 missense probably damaging 0.98
X0017:Prdm2 UTSW 4 143134707 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCTCAGAGGCAGACTTAAGG -3'
(R):5'- TGTCTATGTACCAAGCACAGAGC -3'

Sequencing Primer
(F):5'- GCCGTGGAATCAGAATCTGTCTC -3'
(R):5'- CACAGAGCCCGAGGAGGAC -3'
Posted On2014-08-25