Incidental Mutation 'R2008:Pitpnm2'
ID219206
Institutional Source Beutler Lab
Gene Symbol Pitpnm2
Ensembl Gene ENSMUSG00000029406
Gene Namephosphatidylinositol transfer protein, membrane-associated 2
SynonymsNIR3, RDGBA2, Rdgb2
MMRRC Submission 040017-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2008 (G1)
Quality Score178
Status Not validated
Chromosome5
Chromosomal Location124118690-124249760 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 124152621 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 1 (M1L)
Ref Sequence ENSEMBL: ENSMUSP00000143269 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086123] [ENSMUST00000159677] [ENSMUST00000161273] [ENSMUST00000161644] [ENSMUST00000161938] [ENSMUST00000162812]
Predicted Effect probably benign
Transcript: ENSMUST00000086123
AA Change: M1L

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000083292
Gene: ENSMUSG00000029406
AA Change: M1L

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 6.1e-132 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
low complexity region 507 515 N/A INTRINSIC
Blast:DDHD 548 570 6e-7 BLAST
low complexity region 571 589 N/A INTRINSIC
low complexity region 608 630 N/A INTRINSIC
low complexity region 682 689 N/A INTRINSIC
DDHD 701 895 1.66e-98 SMART
LNS2 1040 1171 3.22e-55 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159677
AA Change: M1L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143269
Gene: ENSMUSG00000029406
AA Change: M1L

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 3.2e-130 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
low complexity region 420 436 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161273
AA Change: M1L

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124292
Gene: ENSMUSG00000029406
AA Change: M1L

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 3.2e-129 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
Blast:DDHD 422 670 2e-65 BLAST
low complexity region 682 689 N/A INTRINSIC
DDHD 701 945 7.5e-100 SMART
LNS2 1090 1221 3.1e-59 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161644
AA Change: M1L

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000161938
AA Change: M1L

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124111
Gene: ENSMUSG00000029406
AA Change: M1L

DomainStartEndE-ValueType
Pfam:IP_trans 1 251 7.5e-116 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
Blast:DDHD 422 670 2e-65 BLAST
low complexity region 682 689 N/A INTRINSIC
DDHD 701 949 8.37e-104 SMART
LNS2 1094 1225 3.22e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162812
AA Change: M1L

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124740
Gene: ENSMUSG00000029406
AA Change: M1L

DomainStartEndE-ValueType
Pfam:IP_trans 1 253 6.1e-132 PFAM
low complexity region 298 319 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
low complexity region 507 515 N/A INTRINSIC
Blast:DDHD 548 570 6e-7 BLAST
low complexity region 571 589 N/A INTRINSIC
low complexity region 608 630 N/A INTRINSIC
low complexity region 682 689 N/A INTRINSIC
DDHD 701 895 1.66e-98 SMART
LNS2 1040 1171 3.22e-55 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PITPNM2 belongs to a family of membrane-associated phosphatidylinositol transfer domain-containing proteins that share homology with the Drosophila retinal degeneration B (rdgB) protein (Ocaka et al., 2005 [PubMed 15627748]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no defects pertaining to photoreceptor function or survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik C T 5: 98,737,702 T156I possibly damaging Het
1700061G19Rik A G 17: 56,886,478 N608S probably benign Het
2510039O18Rik T A 4: 147,941,577 C185S probably benign Het
Actl6b T A 5: 137,569,330 S409T probably damaging Het
Adgrf2 T C 17: 42,710,122 T604A probably damaging Het
Adprhl2 T A 4: 126,317,344 D260V probably benign Het
Akap9 A G 5: 3,960,131 E296G possibly damaging Het
Alg5 A G 3: 54,746,473 Y210C possibly damaging Het
Aoc1 T C 6: 48,905,897 W236R probably damaging Het
Atp11b A G 3: 35,855,122 D1155G probably damaging Het
Atp2c1 T A 9: 105,432,726 T551S probably benign Het
Atp7b A T 8: 22,027,980 C281S probably damaging Het
Bmp1 C T 14: 70,492,466 C466Y probably damaging Het
Cabin1 T C 10: 75,734,976 probably null Het
Capn9 T G 8: 124,591,685 C97G probably damaging Het
Cbfa2t3 A G 8: 122,643,293 V147A probably damaging Het
Ccdc83 T A 7: 90,244,141 Y136F probably damaging Het
Cdh6 C A 15: 13,051,476 R357L possibly damaging Het
Celf1 A T 2: 91,010,408 N367I probably damaging Het
Cep350 T C 1: 155,914,721 I1363V probably benign Het
Colec12 T A 18: 9,874,813 D696E probably benign Het
Ctbp1 C T 5: 33,250,986 E138K probably damaging Het
Cyp4a10 T C 4: 115,525,392 I293T probably damaging Het
D430042O09Rik C G 7: 125,860,566 H1189D probably damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dctn1 C T 6: 83,189,956 T263I probably damaging Het
Ddx49 A T 8: 70,295,444 V317E probably damaging Het
Edil3 G A 13: 88,944,953 probably null Het
Egflam A T 15: 7,237,804 V700E possibly damaging Het
Fam168b A G 1: 34,819,865 probably null Het
Gigyf2 T G 1: 87,374,113 probably null Het
Gm5346 A T 8: 43,627,037 V50D probably benign Het
Heatr4 A G 12: 83,979,740 S248P probably benign Het
Hist1h1c C G 13: 23,739,409 S187R probably benign Het
Hoxd1 A T 2: 74,764,180 I260F possibly damaging Het
Hsd3b3 A T 3: 98,742,092 L305Q probably damaging Het
Itch T A 2: 155,210,459 C660S possibly damaging Het
Ivd A T 2: 118,871,500 I138F probably benign Het
Lcn4 G T 2: 26,671,216 Q18K possibly damaging Het
Mapkbp1 T C 2: 120,012,665 Y192H probably damaging Het
Mn1 T C 5: 111,418,857 L231P probably damaging Het
Morc1 A G 16: 48,565,646 D544G probably benign Het
Mthfd1 C A 12: 76,297,519 T331K probably damaging Het
Myo18b T A 5: 112,873,557 Y546F probably benign Het
Nod1 T C 6: 54,939,325 Y129C probably damaging Het
Nprl3 A G 11: 32,232,973 V563A probably damaging Het
Olfr1253 A T 2: 89,752,073 C252S possibly damaging Het
Olfr46 T C 7: 140,610,585 Y140H probably damaging Het
Olfr497 T C 7: 108,423,182 F204L probably benign Het
Olfr904 T C 9: 38,464,241 S67P probably damaging Het
Olfr998 A G 2: 85,591,422 N294S probably damaging Het
Orc3 T A 4: 34,611,049 probably null Het
Otog T C 7: 46,264,074 V777A probably benign Het
Pbxip1 G T 3: 89,448,713 V711L probably benign Het
Pcdhb16 A G 18: 37,478,263 D92G probably damaging Het
Phkb T A 8: 86,056,467 M964K probably damaging Het
Pkhd1 A G 1: 20,199,459 V3287A probably damaging Het
Polq T A 16: 37,062,482 H1669Q probably damaging Het
Ppp4r4 T C 12: 103,585,757 S195P probably damaging Het
Prdm2 T C 4: 143,134,947 Y591C probably damaging Het
Rgsl1 T A 1: 153,825,905 T268S possibly damaging Het
Scd2 A T 19: 44,303,171 T350S probably benign Het
Scn7a T A 2: 66,687,747 Q1040L possibly damaging Het
Sdhb T A 4: 140,979,029 L259Q probably damaging Het
Senp6 A G 9: 80,126,398 H701R probably damaging Het
Slc41a2 C T 10: 83,304,303 probably null Het
Slx4 T C 16: 3,979,921 D1533G probably damaging Het
Spef2 T C 15: 9,713,185 K367R possibly damaging Het
Sstr3 G A 15: 78,540,511 T12M probably benign Het
Synj2 G T 17: 5,996,946 E20D probably damaging Het
Tchh G T 3: 93,445,974 R907L unknown Het
Thsd1 A G 8: 22,259,231 E645G probably benign Het
Tmem176b A T 6: 48,835,449 M194K probably damaging Het
Tmprss11f T C 5: 86,591,406 probably null Het
Trim44 G A 2: 102,400,377 probably benign Het
Triml1 T A 8: 43,130,605 R320W probably damaging Het
Trmt6 A T 2: 132,806,909 C401* probably null Het
Trpv5 T C 6: 41,659,728 probably null Het
V1rd19 T A 7: 24,003,301 L64* probably null Het
Vmn1r216 A T 13: 23,099,491 R115W probably damaging Het
Vmn2r58 T C 7: 41,860,500 N551S probably damaging Het
Vmn2r77 T C 7: 86,801,713 V269A probably benign Het
Vps13d A T 4: 145,155,243 V1254D probably benign Het
Xpr1 T C 1: 155,281,029 probably null Het
Zan T A 5: 137,452,450 T1622S unknown Het
Zfp112 T C 7: 24,126,751 Y715H probably damaging Het
Zfp750 G A 11: 121,513,125 P308L possibly damaging Het
Other mutations in Pitpnm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Pitpnm2 APN 5 124121663 unclassified probably benign
IGL01660:Pitpnm2 APN 5 124123194 missense probably damaging 1.00
IGL02328:Pitpnm2 APN 5 124121414 missense probably damaging 0.99
IGL02340:Pitpnm2 APN 5 124130613 missense probably damaging 1.00
IGL02399:Pitpnm2 APN 5 124140758 splice site probably benign
IGL02719:Pitpnm2 APN 5 124140602 missense probably damaging 1.00
IGL03053:Pitpnm2 APN 5 124143601 missense probably damaging 1.00
IGL03083:Pitpnm2 APN 5 124133382 missense possibly damaging 0.92
PIT4131001:Pitpnm2 UTSW 5 124131115 missense probably benign 0.01
R0058:Pitpnm2 UTSW 5 124124030 missense probably damaging 1.00
R0437:Pitpnm2 UTSW 5 124131089 splice site probably benign
R0530:Pitpnm2 UTSW 5 124131201 missense probably damaging 1.00
R0568:Pitpnm2 UTSW 5 124140517 splice site probably benign
R0926:Pitpnm2 UTSW 5 124131209 missense probably benign 0.10
R1625:Pitpnm2 UTSW 5 124133433 missense probably benign 0.05
R2120:Pitpnm2 UTSW 5 124127269 missense probably damaging 1.00
R2354:Pitpnm2 UTSW 5 124122919 missense probably damaging 0.99
R2448:Pitpnm2 UTSW 5 124123994 missense probably damaging 1.00
R2509:Pitpnm2 UTSW 5 124136326 missense probably damaging 0.99
R2510:Pitpnm2 UTSW 5 124136326 missense probably damaging 0.99
R2511:Pitpnm2 UTSW 5 124136326 missense probably damaging 0.99
R2520:Pitpnm2 UTSW 5 124129401 missense probably damaging 0.96
R2860:Pitpnm2 UTSW 5 124121437 missense probably damaging 1.00
R2861:Pitpnm2 UTSW 5 124121437 missense probably damaging 1.00
R4407:Pitpnm2 UTSW 5 124152615 missense possibly damaging 0.57
R4417:Pitpnm2 UTSW 5 124123569 missense probably damaging 1.00
R4426:Pitpnm2 UTSW 5 124142123 missense probably benign 0.32
R4458:Pitpnm2 UTSW 5 124121376 missense probably benign 0.00
R4610:Pitpnm2 UTSW 5 124125371 missense probably damaging 0.99
R4786:Pitpnm2 UTSW 5 124121743 nonsense probably null
R4903:Pitpnm2 UTSW 5 124152605 missense probably damaging 1.00
R5151:Pitpnm2 UTSW 5 124136386 missense probably damaging 1.00
R5315:Pitpnm2 UTSW 5 124121933 missense probably benign 0.18
R5592:Pitpnm2 UTSW 5 124142149 missense probably damaging 1.00
R5792:Pitpnm2 UTSW 5 124130321 nonsense probably null
R6846:Pitpnm2 UTSW 5 124131171 missense probably benign 0.00
R6983:Pitpnm2 UTSW 5 124133406 missense probably damaging 1.00
R7096:Pitpnm2 UTSW 5 124129261 missense possibly damaging 0.69
R7188:Pitpnm2 UTSW 5 124121303 missense probably benign 0.31
R7203:Pitpnm2 UTSW 5 124121459 missense probably damaging 0.96
R7237:Pitpnm2 UTSW 5 124125297 critical splice donor site probably null
R7257:Pitpnm2 UTSW 5 124125356 missense possibly damaging 0.88
R7622:Pitpnm2 UTSW 5 124122027 missense probably benign 0.39
R7677:Pitpnm2 UTSW 5 124123569 missense probably damaging 1.00
R7736:Pitpnm2 UTSW 5 124123030 missense possibly damaging 0.47
R7745:Pitpnm2 UTSW 5 124128705 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CGAAAGCAGTCCATGTCCAC -3'
(R):5'- TTGGGTAGCTCTTCAAGATTGCTC -3'

Sequencing Primer
(F):5'- CAGGCGGTACCCAGTAGTGTAG -3'
(R):5'- AAGGAATTTGCTCCAGGTCG -3'
Posted On2014-08-25