Incidental Mutation 'R2008:D430042O09Rik'
ID219237
Institutional Source Beutler Lab
Gene Symbol D430042O09Rik
Ensembl Gene ENSMUSG00000032743
Gene NameRIKEN cDNA D430042O09 gene
Synonyms
MMRRC Submission 040017-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2008 (G1)
Quality Score178
Status Not validated
Chromosome7
Chromosomal Location125707888-125874793 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 125860566 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Aspartic acid at position 1189 (H1189D)
Ref Sequence ENSEMBL: ENSMUSP00000118668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069660] [ENSMUST00000124223]
Predicted Effect probably damaging
Transcript: ENSMUST00000069660
AA Change: H1215D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000065744
Gene: ENSMUSG00000032743
AA Change: H1215D

DomainStartEndE-ValueType
internal_repeat_3 442 586 9.64e-5 PROSPERO
internal_repeat_2 454 607 1.91e-6 PROSPERO
low complexity region 704 718 N/A INTRINSIC
Pfam:DUF4457 909 1099 5.1e-43 PFAM
Pfam:DUF4457 1205 1524 8.4e-149 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122337
SMART Domains Protein: ENSMUSP00000113734
Gene: ENSMUSG00000032743

DomainStartEndE-ValueType
Pfam:DUF4457 173 344 2.7e-9 PFAM
Pfam:DUF4457 218 394 3.2e-10 PFAM
low complexity region 444 458 N/A INTRINSIC
Pfam:DUF4457 660 742 1.1e-14 PFAM
Pfam:DUF4457 733 863 2.6e-31 PFAM
Pfam:DUF4457 944 1008 5.9e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124223
AA Change: H1189D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118668
Gene: ENSMUSG00000032743
AA Change: H1189D

DomainStartEndE-ValueType
internal_repeat_3 416 560 8.9e-5 PROSPERO
internal_repeat_2 428 581 1.74e-6 PROSPERO
low complexity region 678 692 N/A INTRINSIC
Pfam:DUF4457 882 1073 1.4e-39 PFAM
Pfam:DUF4457 1179 1498 2.2e-145 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132204
SMART Domains Protein: ENSMUSP00000115955
Gene: ENSMUSG00000032743

DomainStartEndE-ValueType
Pfam:DUF4457 1 143 3.6e-51 PFAM
Pfam:DUF4457 139 219 2.4e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155059
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205462
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a novel, evolutionarily conserved, ciliary protein. In human hTERT-RPE1 cells, the protein is found at the base of cilia, decorating the ciliary axoneme, and enriched at the ciliary tip. The protein binds to microtubules in vitro and regulates their stability when it is overexpressed. A null mutation in this gene has been associated with Joubert syndrome, a recessive disorder that is characterized by a distinctive mid-hindbrain and cerebellar malformation and is also often associated with wider ciliopathy symptoms. Consistently, in a serum-starvation ciliogenesis assay, human fibroblast cells derived from patients with the mutation display a reduced number of ciliated cells with abnormally long cilia. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit variable obstructive hydrocephaly and enlarged lateral ventricles resulting from a blockage of cerebrospinal fluid flow in the cerebral aqueduct but show no gross defects in ventricular ependymal cilium structure or motility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik C T 5: 98,737,702 T156I possibly damaging Het
1700061G19Rik A G 17: 56,886,478 N608S probably benign Het
2510039O18Rik T A 4: 147,941,577 C185S probably benign Het
Actl6b T A 5: 137,569,330 S409T probably damaging Het
Adgrf2 T C 17: 42,710,122 T604A probably damaging Het
Adprhl2 T A 4: 126,317,344 D260V probably benign Het
Akap9 A G 5: 3,960,131 E296G possibly damaging Het
Alg5 A G 3: 54,746,473 Y210C possibly damaging Het
Aoc1 T C 6: 48,905,897 W236R probably damaging Het
Atp11b A G 3: 35,855,122 D1155G probably damaging Het
Atp2c1 T A 9: 105,432,726 T551S probably benign Het
Atp7b A T 8: 22,027,980 C281S probably damaging Het
Bmp1 C T 14: 70,492,466 C466Y probably damaging Het
Cabin1 T C 10: 75,734,976 probably null Het
Capn9 T G 8: 124,591,685 C97G probably damaging Het
Cbfa2t3 A G 8: 122,643,293 V147A probably damaging Het
Ccdc83 T A 7: 90,244,141 Y136F probably damaging Het
Cdh6 C A 15: 13,051,476 R357L possibly damaging Het
Celf1 A T 2: 91,010,408 N367I probably damaging Het
Cep350 T C 1: 155,914,721 I1363V probably benign Het
Colec12 T A 18: 9,874,813 D696E probably benign Het
Ctbp1 C T 5: 33,250,986 E138K probably damaging Het
Cyp4a10 T C 4: 115,525,392 I293T probably damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dctn1 C T 6: 83,189,956 T263I probably damaging Het
Ddx49 A T 8: 70,295,444 V317E probably damaging Het
Edil3 G A 13: 88,944,953 probably null Het
Egflam A T 15: 7,237,804 V700E possibly damaging Het
Fam168b A G 1: 34,819,865 probably null Het
Gigyf2 T G 1: 87,374,113 probably null Het
Gm5346 A T 8: 43,627,037 V50D probably benign Het
Heatr4 A G 12: 83,979,740 S248P probably benign Het
Hist1h1c C G 13: 23,739,409 S187R probably benign Het
Hoxd1 A T 2: 74,764,180 I260F possibly damaging Het
Hsd3b3 A T 3: 98,742,092 L305Q probably damaging Het
Itch T A 2: 155,210,459 C660S possibly damaging Het
Ivd A T 2: 118,871,500 I138F probably benign Het
Lcn4 G T 2: 26,671,216 Q18K possibly damaging Het
Mapkbp1 T C 2: 120,012,665 Y192H probably damaging Het
Mn1 T C 5: 111,418,857 L231P probably damaging Het
Morc1 A G 16: 48,565,646 D544G probably benign Het
Mthfd1 C A 12: 76,297,519 T331K probably damaging Het
Myo18b T A 5: 112,873,557 Y546F probably benign Het
Nod1 T C 6: 54,939,325 Y129C probably damaging Het
Nprl3 A G 11: 32,232,973 V563A probably damaging Het
Olfr1253 A T 2: 89,752,073 C252S possibly damaging Het
Olfr46 T C 7: 140,610,585 Y140H probably damaging Het
Olfr497 T C 7: 108,423,182 F204L probably benign Het
Olfr904 T C 9: 38,464,241 S67P probably damaging Het
Olfr998 A G 2: 85,591,422 N294S probably damaging Het
Orc3 T A 4: 34,611,049 probably null Het
Otog T C 7: 46,264,074 V777A probably benign Het
Pbxip1 G T 3: 89,448,713 V711L probably benign Het
Pcdhb16 A G 18: 37,478,263 D92G probably damaging Het
Phkb T A 8: 86,056,467 M964K probably damaging Het
Pitpnm2 T A 5: 124,152,621 M1L probably damaging Het
Pkhd1 A G 1: 20,199,459 V3287A probably damaging Het
Polq T A 16: 37,062,482 H1669Q probably damaging Het
Ppp4r4 T C 12: 103,585,757 S195P probably damaging Het
Prdm2 T C 4: 143,134,947 Y591C probably damaging Het
Rgsl1 T A 1: 153,825,905 T268S possibly damaging Het
Scd2 A T 19: 44,303,171 T350S probably benign Het
Scn7a T A 2: 66,687,747 Q1040L possibly damaging Het
Sdhb T A 4: 140,979,029 L259Q probably damaging Het
Senp6 A G 9: 80,126,398 H701R probably damaging Het
Slc41a2 C T 10: 83,304,303 probably null Het
Slx4 T C 16: 3,979,921 D1533G probably damaging Het
Spef2 T C 15: 9,713,185 K367R possibly damaging Het
Sstr3 G A 15: 78,540,511 T12M probably benign Het
Synj2 G T 17: 5,996,946 E20D probably damaging Het
Tchh G T 3: 93,445,974 R907L unknown Het
Thsd1 A G 8: 22,259,231 E645G probably benign Het
Tmem176b A T 6: 48,835,449 M194K probably damaging Het
Tmprss11f T C 5: 86,591,406 probably null Het
Trim44 G A 2: 102,400,377 probably benign Het
Triml1 T A 8: 43,130,605 R320W probably damaging Het
Trmt6 A T 2: 132,806,909 C401* probably null Het
Trpv5 T C 6: 41,659,728 probably null Het
V1rd19 T A 7: 24,003,301 L64* probably null Het
Vmn1r216 A T 13: 23,099,491 R115W probably damaging Het
Vmn2r58 T C 7: 41,860,500 N551S probably damaging Het
Vmn2r77 T C 7: 86,801,713 V269A probably benign Het
Vps13d A T 4: 145,155,243 V1254D probably benign Het
Xpr1 T C 1: 155,281,029 probably null Het
Zan T A 5: 137,452,450 T1622S unknown Het
Zfp112 T C 7: 24,126,751 Y715H probably damaging Het
Zfp750 G A 11: 121,513,125 P308L possibly damaging Het
Other mutations in D430042O09Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00697:D430042O09Rik APN 7 125795450 missense possibly damaging 0.75
IGL00950:D430042O09Rik APN 7 125843221 missense probably benign
IGL01089:D430042O09Rik APN 7 125795313 missense probably damaging 1.00
IGL01099:D430042O09Rik APN 7 125865320 missense probably damaging 1.00
IGL01449:D430042O09Rik APN 7 125870685 missense probably damaging 1.00
IGL01545:D430042O09Rik APN 7 125752971 critical splice acceptor site probably null
IGL01937:D430042O09Rik APN 7 125854605 missense probably benign 0.13
IGL01949:D430042O09Rik APN 7 125761842 nonsense probably null
IGL02096:D430042O09Rik APN 7 125814821 missense probably benign 0.09
IGL02148:D430042O09Rik APN 7 125873476 unclassified probably null
IGL02274:D430042O09Rik APN 7 125770570 critical splice acceptor site probably null
IGL02323:D430042O09Rik APN 7 125842829 missense probably benign 0.04
IGL02574:D430042O09Rik APN 7 125829753 missense possibly damaging 0.48
IGL02639:D430042O09Rik APN 7 125872792 missense probably damaging 1.00
IGL02833:D430042O09Rik APN 7 125850412 nonsense probably null
IGL03003:D430042O09Rik APN 7 125851960 missense probably damaging 1.00
IGL03011:D430042O09Rik APN 7 125852002 missense probably benign 0.01
IGL03332:D430042O09Rik APN 7 125820105 nonsense probably null
IGL03368:D430042O09Rik APN 7 125868858 intron probably benign
E0370:D430042O09Rik UTSW 7 125850302 missense probably benign 0.06
PIT4498001:D430042O09Rik UTSW 7 125813596 missense probably benign
R0033:D430042O09Rik UTSW 7 125761827 missense possibly damaging 0.77
R0033:D430042O09Rik UTSW 7 125761827 missense possibly damaging 0.77
R0234:D430042O09Rik UTSW 7 125795385 missense probably benign 0.00
R0234:D430042O09Rik UTSW 7 125795385 missense probably benign 0.00
R0472:D430042O09Rik UTSW 7 125872967 missense probably damaging 0.98
R0479:D430042O09Rik UTSW 7 125843346 missense probably benign 0.20
R1195:D430042O09Rik UTSW 7 125866482 missense probably damaging 1.00
R1195:D430042O09Rik UTSW 7 125866482 missense probably damaging 1.00
R1195:D430042O09Rik UTSW 7 125866482 missense probably damaging 1.00
R1223:D430042O09Rik UTSW 7 125760423 missense possibly damaging 0.75
R1299:D430042O09Rik UTSW 7 125852023 missense probably benign
R1331:D430042O09Rik UTSW 7 125866455 missense probably benign 0.00
R1484:D430042O09Rik UTSW 7 125816571 splice site probably benign
R1507:D430042O09Rik UTSW 7 125866352 missense probably damaging 1.00
R1562:D430042O09Rik UTSW 7 125842848 missense probably damaging 1.00
R1992:D430042O09Rik UTSW 7 125820089 missense probably benign 0.00
R2010:D430042O09Rik UTSW 7 125872956 missense possibly damaging 0.93
R2147:D430042O09Rik UTSW 7 125865320 missense probably damaging 1.00
R2508:D430042O09Rik UTSW 7 125795343 missense probably benign
R3015:D430042O09Rik UTSW 7 125866340 missense probably damaging 1.00
R3794:D430042O09Rik UTSW 7 125820089 missense probably benign 0.00
R3795:D430042O09Rik UTSW 7 125820089 missense probably benign 0.00
R4043:D430042O09Rik UTSW 7 125868741 missense probably benign 0.30
R4044:D430042O09Rik UTSW 7 125868741 missense probably benign 0.30
R4692:D430042O09Rik UTSW 7 125867669 critical splice donor site probably null
R4772:D430042O09Rik UTSW 7 125865351 missense probably damaging 0.96
R5155:D430042O09Rik UTSW 7 125872184 missense probably damaging 1.00
R5467:D430042O09Rik UTSW 7 125843355 missense possibly damaging 0.65
R5551:D430042O09Rik UTSW 7 125820077 missense probably damaging 1.00
R5560:D430042O09Rik UTSW 7 125854561 missense probably benign 0.00
R5662:D430042O09Rik UTSW 7 125842703 missense probably benign 0.00
R5667:D430042O09Rik UTSW 7 125843455 critical splice donor site probably null
R5838:D430042O09Rik UTSW 7 125867655 missense possibly damaging 0.88
R5958:D430042O09Rik UTSW 7 125813635 missense probably benign 0.01
R5983:D430042O09Rik UTSW 7 125850373 missense probably damaging 1.00
R6084:D430042O09Rik UTSW 7 125814865 missense probably benign
R6241:D430042O09Rik UTSW 7 125872834 missense probably benign 0.00
R6298:D430042O09Rik UTSW 7 125870697 missense probably benign 0.11
R6345:D430042O09Rik UTSW 7 125752987 missense probably damaging 0.97
R6554:D430042O09Rik UTSW 7 125850742 missense probably damaging 1.00
R6715:D430042O09Rik UTSW 7 125761829 nonsense probably null
R6745:D430042O09Rik UTSW 7 125770650 missense probably benign 0.00
R7178:D430042O09Rik UTSW 7 125866327 missense probably benign 0.00
R7210:D430042O09Rik UTSW 7 125872239 missense probably damaging 1.00
R7404:D430042O09Rik UTSW 7 125865262 missense probably damaging 1.00
R7561:D430042O09Rik UTSW 7 125842722 missense probably benign
R7571:D430042O09Rik UTSW 7 125708021 unclassified probably benign
R7584:D430042O09Rik UTSW 7 125870666 missense probably damaging 0.99
R7629:D430042O09Rik UTSW 7 125795250 missense probably damaging 0.96
R7676:D430042O09Rik UTSW 7 125850377 missense probably benign 0.26
R7748:D430042O09Rik UTSW 7 125829801 missense probably benign 0.00
R7786:D430042O09Rik UTSW 7 125865294 missense probably benign 0.19
R8058:D430042O09Rik UTSW 7 125843016 missense probably benign 0.17
U24488:D430042O09Rik UTSW 7 125770681 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGAAAGGAACACCTCACTGC -3'
(R):5'- AACTGCCACAGTCAAGCTTC -3'

Sequencing Primer
(F):5'- TCCAGCTGTGTGGGCTC -3'
(R):5'- AGCTTCTAATACTTACTTGTCCAGGG -3'
Posted On2014-08-25