Incidental Mutation 'R1968:Myocd'
ID219262
Institutional Source Beutler Lab
Gene Symbol Myocd
Ensembl Gene ENSMUSG00000020542
Gene Namemyocardin
SynonymsSrfcp
MMRRC Submission 039981-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1968 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location65176561-65269989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 65200907 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 70 (G70C)
Ref Sequence ENSEMBL: ENSMUSP00000098603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101042] [ENSMUST00000102635] [ENSMUST00000108695]
Predicted Effect probably damaging
Transcript: ENSMUST00000101042
AA Change: G70C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098603
Gene: ENSMUSG00000020542
AA Change: G70C

DomainStartEndE-ValueType
low complexity region 19 32 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
SCOP:d1lsha3 140 221 4e-3 SMART
SAP 252 286 1.29e-8 SMART
low complexity region 326 343 N/A INTRINSIC
low complexity region 371 383 N/A INTRINSIC
coiled coil region 396 435 N/A INTRINSIC
low complexity region 557 573 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102635
AA Change: G198C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099695
Gene: ENSMUSG00000020542
AA Change: G198C

DomainStartEndE-ValueType
RPEL 18 43 4e-1 SMART
RPEL 62 87 9.26e0 SMART
RPEL 106 131 1.15e-6 SMART
low complexity region 147 160 N/A INTRINSIC
low complexity region 247 260 N/A INTRINSIC
SCOP:d1lsha3 268 349 4e-3 SMART
SAP 380 414 1.29e-8 SMART
low complexity region 454 471 N/A INTRINSIC
low complexity region 499 511 N/A INTRINSIC
coiled coil region 524 563 N/A INTRINSIC
low complexity region 695 709 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108695
AA Change: G198C

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000104335
Gene: ENSMUSG00000020542
AA Change: G198C

DomainStartEndE-ValueType
RPEL 18 43 4e-1 SMART
RPEL 62 87 9.26e0 SMART
RPEL 106 131 1.15e-6 SMART
low complexity region 147 160 N/A INTRINSIC
low complexity region 247 260 N/A INTRINSIC
SCOP:d1lsha3 268 349 5e-3 SMART
SAP 380 414 1.29e-8 SMART
low complexity region 454 471 N/A INTRINSIC
low complexity region 499 511 N/A INTRINSIC
coiled coil region 524 563 N/A INTRINSIC
low complexity region 685 701 N/A INTRINSIC
low complexity region 743 757 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000144399
AA Change: G72C
SMART Domains Protein: ENSMUSP00000115572
Gene: ENSMUSG00000020542
AA Change: G72C

DomainStartEndE-ValueType
low complexity region 22 35 N/A INTRINSIC
low complexity region 122 135 N/A INTRINSIC
low complexity region 160 195 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein, which is expressed in heart, aorta, and in smooth muscle cell-containing tissues. It functions as a transcriptional co-activator of serum response factor (SRF) and modulates expression of cardiac and smooth muscle-specific SRF-target genes, and thus may play a crucial role in cardiogenesis and differentiation of the smooth muscle cell lineage. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null mutation exhibit embryonic lethality and fail to form vascular smooth muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,322,199 L528Q probably damaging Het
Adam18 T A 8: 24,646,447 T353S probably benign Het
Aldh1a3 A G 7: 66,411,500 probably null Het
Aldh3b2 T A 19: 3,980,705 M390K probably benign Het
Arhgap45 T C 10: 80,027,702 I793T probably damaging Het
Arsb A G 13: 93,807,559 M253V probably benign Het
Atcay T C 10: 81,212,478 D258G possibly damaging Het
Atf1 G T 15: 100,254,514 probably null Het
Atp1a4 C T 1: 172,240,164 E511K probably benign Het
Atp8a1 A G 5: 67,667,657 V777A probably benign Het
Baz1a T C 12: 54,900,337 T1173A possibly damaging Het
Bdh2 A T 3: 135,285,609 D15V probably benign Het
Cacna1e T C 1: 154,700,494 Y69C probably damaging Het
Caskin2 A G 11: 115,803,614 L387P probably benign Het
Cat T C 2: 103,484,989 E17G probably benign Het
Ccdc15 T C 9: 37,347,795 I54M probably benign Het
Cdhr1 T G 14: 37,079,725 I754L probably benign Het
Cep120 G A 18: 53,723,241 T368I probably benign Het
Cep126 C A 9: 8,100,908 D542Y probably damaging Het
Cep135 T C 5: 76,624,747 S660P possibly damaging Het
Cfap70 A T 14: 20,420,811 S455R possibly damaging Het
Chd8 A G 14: 52,220,993 M886T probably damaging Het
Ckap5 T C 2: 91,586,343 S1098P probably benign Het
Clec4e A T 6: 123,283,574 I204N probably damaging Het
Cntnap5c G A 17: 58,359,296 R1107H probably damaging Het
Cramp1l T C 17: 24,964,939 D1234G probably damaging Het
Csf1r A T 18: 61,112,795 I275L probably benign Het
Cyp27a1 A G 1: 74,737,276 E457G probably benign Het
Cyp2d11 T C 15: 82,389,548 T410A probably benign Het
Cyp2d22 G C 15: 82,373,172 T264S probably benign Het
Cyr61 T C 3: 145,648,210 Y275C probably damaging Het
Daam2 G A 17: 49,483,060 R390W probably damaging Het
Decr2 T C 17: 26,083,079 S226G probably benign Het
Dennd6b T C 15: 89,190,341 D91G possibly damaging Het
Dglucy T C 12: 100,859,644 V515A possibly damaging Het
Dlg5 A T 14: 24,164,119 L734* probably null Het
Dopey2 A G 16: 93,782,419 N1690D probably damaging Het
Exoc5 A G 14: 49,034,890 Y356H probably benign Het
Fut7 T A 2: 25,425,726 V332D probably benign Het
Gm436 A G 4: 144,670,623 Y180H possibly damaging Het
Gnas T C 2: 174,298,733 S232P probably damaging Het
Gramd4 A G 15: 86,132,905 E522G probably damaging Het
Gys1 A G 7: 45,443,546 T297A probably damaging Het
Herc4 T C 10: 63,273,525 S180P probably benign Het
Hivep3 C T 4: 120,096,238 P584S possibly damaging Het
Itpk1 G T 12: 102,675,470 probably null Het
Jmjd1c A T 10: 67,225,440 S1191C probably damaging Het
Lima1 T C 15: 99,819,684 N147S probably benign Het
Lrmp T A 6: 145,169,773 S310T probably damaging Het
Map4k5 G A 12: 69,818,492 T506I probably damaging Het
Mat1a A T 14: 41,111,034 E58V probably damaging Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Mon2 A G 10: 123,009,565 Y1413H probably damaging Het
Mpp3 C A 11: 102,018,552 probably benign Het
Mpp4 T A 1: 59,144,802 I260F probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nckap5 T A 1: 126,014,630 D209V probably damaging Het
Nlrp9a A G 7: 26,564,941 K707R probably benign Het
Npr3 A G 15: 11,904,969 L224S probably benign Het
Olfr1036 T A 2: 86,075,205 L155Q probably damaging Het
Olfr1153 T A 2: 87,897,039 V280E probably damaging Het
Olfr821 A G 10: 130,033,733 S36G probably damaging Het
Otof C T 5: 30,388,654 D467N probably damaging Het
Paxx T C 2: 25,460,628 probably benign Het
Pcmt1 G A 10: 7,640,710 R179* probably null Het
Phkb T A 8: 85,970,951 V463D probably benign Het
Prkcq T C 2: 11,245,397 V175A probably damaging Het
Rasl11b T G 5: 74,196,136 I58S probably damaging Het
Rb1cc1 A T 1: 6,248,195 probably null Het
Reck T A 4: 43,913,771 probably null Het
Riox1 G T 12: 83,951,382 D231Y probably damaging Het
Rlf T A 4: 121,148,420 N1231I probably damaging Het
Rpn1 A G 6: 88,095,548 D291G possibly damaging Het
Samsn1 C T 16: 75,945,573 noncoding transcript Het
Scara5 T C 14: 65,689,800 C49R possibly damaging Het
Serpini1 A G 3: 75,614,478 D92G probably benign Het
Setdb2 A T 14: 59,419,409 L153Q probably damaging Het
Sh3rf3 C T 10: 58,813,987 T138M probably benign Het
Shkbp1 C T 7: 27,355,400 probably null Het
Slc22a29 G A 19: 8,218,343 P111S probably benign Het
Smarca1 A G X: 47,852,687 V618A probably damaging Het
Spef2 T A 15: 9,609,516 M1308L probably damaging Het
Spink5 A G 18: 43,990,708 N354S probably benign Het
Srrm2 T C 17: 23,821,491 S2370P probably damaging Het
Ssxb3 A T X: 8,588,666 I28N probably damaging Het
Sucla2 A G 14: 73,593,679 T411A probably damaging Het
Tex38 A C 4: 115,780,340 S89A probably benign Het
Tjp2 A T 19: 24,111,073 D723E probably damaging Het
Tln2 A T 9: 67,255,901 N1121K probably damaging Het
Tti1 T C 2: 158,009,046 E91G possibly damaging Het
Wbp2 A T 11: 116,082,365 M72K possibly damaging Het
Wdfy4 C A 14: 33,106,044 C1062F possibly damaging Het
Wiz A G 17: 32,359,372 Y389H probably damaging Het
Zcchc3 T C 2: 152,414,092 K229R probably damaging Het
Zmat3 C A 3: 32,360,982 D60Y probably damaging Het
Other mutations in Myocd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Myocd APN 11 65180944 critical splice acceptor site probably null
IGL00481:Myocd APN 11 65187154 missense probably damaging 0.99
IGL00857:Myocd APN 11 65178836 missense possibly damaging 0.93
IGL01012:Myocd APN 11 65184625 missense possibly damaging 0.51
IGL01570:Myocd APN 11 65200807 missense probably benign 0.00
IGL01865:Myocd APN 11 65200897 missense probably benign 0.30
IGL01938:Myocd APN 11 65187088 missense probably damaging 1.00
IGL02324:Myocd APN 11 65178658 missense probably benign 0.01
IGL02598:Myocd APN 11 65183470 missense probably benign 0.31
IGL02886:Myocd APN 11 65178743 missense probably damaging 0.99
IGL03008:Myocd APN 11 65187566 missense probably damaging 0.98
IGL03034:Myocd APN 11 65218685 missense probably benign 0.00
harvey UTSW 11 65179030 splice site probably null
irma UTSW 11 65196394 missense probably damaging 0.97
Nate UTSW 11 65233088 intron probably null
R0078:Myocd UTSW 11 65187464 missense possibly damaging 0.96
R0097:Myocd UTSW 11 65179014 missense possibly damaging 0.67
R0097:Myocd UTSW 11 65179014 missense possibly damaging 0.67
R0234:Myocd UTSW 11 65187240 missense probably benign 0.01
R0234:Myocd UTSW 11 65187240 missense probably benign 0.01
R0453:Myocd UTSW 11 65196225 missense probably damaging 1.00
R0523:Myocd UTSW 11 65180902 missense probably damaging 1.00
R0838:Myocd UTSW 11 65178932 missense probably benign 0.00
R0899:Myocd UTSW 11 65195192 missense possibly damaging 0.50
R1167:Myocd UTSW 11 65196377 missense possibly damaging 0.77
R1472:Myocd UTSW 11 65187504 missense probably benign 0.01
R1508:Myocd UTSW 11 65184516 missense probably damaging 0.98
R1620:Myocd UTSW 11 65196394 missense probably damaging 0.97
R1630:Myocd UTSW 11 65196394 missense probably damaging 0.97
R1731:Myocd UTSW 11 65200888 missense probably benign 0.30
R1740:Myocd UTSW 11 65218521 splice site probably benign
R1769:Myocd UTSW 11 65178701 missense probably benign 0.01
R1823:Myocd UTSW 11 65178670 missense probably benign 0.00
R1997:Myocd UTSW 11 65204321 nonsense probably null
R2018:Myocd UTSW 11 65187028 missense probably damaging 1.00
R2105:Myocd UTSW 11 65218658 nonsense probably null
R2314:Myocd UTSW 11 65200807 missense probably damaging 1.00
R4330:Myocd UTSW 11 65223764 missense probably benign 0.12
R4331:Myocd UTSW 11 65223764 missense probably benign 0.12
R4603:Myocd UTSW 11 65187745 missense possibly damaging 0.82
R4619:Myocd UTSW 11 65178428 utr 3 prime probably benign
R4631:Myocd UTSW 11 65178859 missense probably benign 0.10
R4865:Myocd UTSW 11 65179030 splice site probably null
R4974:Myocd UTSW 11 65183473 missense possibly damaging 0.78
R4976:Myocd UTSW 11 65222050 missense probably benign 0.00
R5478:Myocd UTSW 11 65233088 intron probably null
R5499:Myocd UTSW 11 65178749 missense possibly damaging 0.62
R6052:Myocd UTSW 11 65196256 missense probably damaging 1.00
R6356:Myocd UTSW 11 65218570 unclassified probably null
R7144:Myocd UTSW 11 65218648 missense probably damaging 1.00
R7261:Myocd UTSW 11 65187596 missense probably damaging 0.98
R7354:Myocd UTSW 11 65187493 missense probably benign 0.00
R7461:Myocd UTSW 11 65218603 missense probably damaging 1.00
R7613:Myocd UTSW 11 65218603 missense probably damaging 1.00
R7718:Myocd UTSW 11 65218626 missense probably damaging 1.00
X0057:Myocd UTSW 11 65183445 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- TTGCCTGAACCTGTGTCTGC -3'
(R):5'- TCTCAGAGGTAGCTTTGAAGTG -3'

Sequencing Primer
(F):5'- AAGCTCTGCTTCGCATGG -3'
(R):5'- AGCTTTGAAGTGGGTGACATATTG -3'
Posted On2014-08-25