Incidental Mutation 'R1968:Wbp2'
ID219267
Institutional Source Beutler Lab
Gene Symbol Wbp2
Ensembl Gene ENSMUSG00000034341
Gene NameWW domain binding protein 2
Synonyms
MMRRC Submission 039981-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1968 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location116078573-116086995 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116082365 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 72 (M72K)
Ref Sequence ENSEMBL: ENSMUSP00000102052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074628] [ENSMUST00000075036] [ENSMUST00000106444] [ENSMUST00000106450] [ENSMUST00000106451] [ENSMUST00000156545] [ENSMUST00000173345] [ENSMUST00000174822]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074628
AA Change: M72K

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074204
Gene: ENSMUSG00000034341
AA Change: M72K

DomainStartEndE-ValueType
Pfam:GRAM 1 84 1.2e-19 PFAM
Pfam:WWbp 100 204 1.3e-20 PFAM
low complexity region 247 255 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000075036
SMART Domains Protein: ENSMUSP00000074549
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 585 735 8e-6 PDB
low complexity region 738 751 N/A INTRINSIC
Pfam:Membr_traf_MHD 785 892 1.9e-25 PFAM
C2 923 1031 7.93e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106444
AA Change: M72K

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000102052
Gene: ENSMUSG00000034341
AA Change: M72K

DomainStartEndE-ValueType
Pfam:GRAM 1 84 2.3e-19 PFAM
Pfam:WWbp 100 212 5.3e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106450
SMART Domains Protein: ENSMUSP00000102058
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 8e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Pfam:Membr_traf_MHD 787 894 1.9e-25 PFAM
C2 925 1033 7.93e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106451
SMART Domains Protein: ENSMUSP00000102059
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 8e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Pfam:Membr_traf_MHD 788 838 7.1e-10 PFAM
Pfam:Membr_traf_MHD 830 893 1.4e-15 PFAM
C2 925 1033 7.93e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129532
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146339
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155120
Predicted Effect probably benign
Transcript: ENSMUST00000156545
SMART Domains Protein: ENSMUSP00000118266
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173345
SMART Domains Protein: ENSMUSP00000133679
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 587 737 5e-6 PDB
low complexity region 740 753 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174822
SMART Domains Protein: ENSMUSP00000134260
Gene: ENSMUSG00000057948

DomainStartEndE-ValueType
low complexity region 21 26 N/A INTRINSIC
C2 111 261 5.31e-11 SMART
PDB:3SWH|B 585 735 8e-6 PDB
low complexity region 738 751 N/A INTRINSIC
Pfam:Membr_traf_MHD 785 892 1.9e-25 PFAM
C2 923 1031 7.93e-10 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The globular WW domain is composed of 38 to 40 semiconserved amino acids shared by proteins of diverse functions including structural, regulatory, and signaling proteins. The domain is involved in mediating protein-protein interactions through the binding of polyproline ligands. This gene encodes a WW domain binding protein that is a transcriptional coactivator of estrogen receptor alpha and progesterone receptor. Defects in this gene have been associated with hearing impairment. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a null allele show progressive high-frequency hearing loss, raised auditory brainstem response (ABR) thresholds, reduced ABR amplitudes, swelling of afferent terminals, inner hair cell synapse defects, and altered expression of AMPA receptor subunits and post-synaptic proteins. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,322,199 L528Q probably damaging Het
Adam18 T A 8: 24,646,447 T353S probably benign Het
Aldh1a3 A G 7: 66,411,500 probably null Het
Aldh3b2 T A 19: 3,980,705 M390K probably benign Het
Arhgap45 T C 10: 80,027,702 I793T probably damaging Het
Arsb A G 13: 93,807,559 M253V probably benign Het
Atcay T C 10: 81,212,478 D258G possibly damaging Het
Atf1 G T 15: 100,254,514 probably null Het
Atp1a4 C T 1: 172,240,164 E511K probably benign Het
Atp8a1 A G 5: 67,667,657 V777A probably benign Het
Baz1a T C 12: 54,900,337 T1173A possibly damaging Het
Bdh2 A T 3: 135,285,609 D15V probably benign Het
Cacna1e T C 1: 154,700,494 Y69C probably damaging Het
Caskin2 A G 11: 115,803,614 L387P probably benign Het
Cat T C 2: 103,484,989 E17G probably benign Het
Ccdc15 T C 9: 37,347,795 I54M probably benign Het
Cdhr1 T G 14: 37,079,725 I754L probably benign Het
Cep120 G A 18: 53,723,241 T368I probably benign Het
Cep126 C A 9: 8,100,908 D542Y probably damaging Het
Cep135 T C 5: 76,624,747 S660P possibly damaging Het
Cfap70 A T 14: 20,420,811 S455R possibly damaging Het
Chd8 A G 14: 52,220,993 M886T probably damaging Het
Ckap5 T C 2: 91,586,343 S1098P probably benign Het
Clec4e A T 6: 123,283,574 I204N probably damaging Het
Cntnap5c G A 17: 58,359,296 R1107H probably damaging Het
Cramp1l T C 17: 24,964,939 D1234G probably damaging Het
Csf1r A T 18: 61,112,795 I275L probably benign Het
Cyp27a1 A G 1: 74,737,276 E457G probably benign Het
Cyp2d11 T C 15: 82,389,548 T410A probably benign Het
Cyp2d22 G C 15: 82,373,172 T264S probably benign Het
Cyr61 T C 3: 145,648,210 Y275C probably damaging Het
Daam2 G A 17: 49,483,060 R390W probably damaging Het
Decr2 T C 17: 26,083,079 S226G probably benign Het
Dennd6b T C 15: 89,190,341 D91G possibly damaging Het
Dglucy T C 12: 100,859,644 V515A possibly damaging Het
Dlg5 A T 14: 24,164,119 L734* probably null Het
Dopey2 A G 16: 93,782,419 N1690D probably damaging Het
Exoc5 A G 14: 49,034,890 Y356H probably benign Het
Fut7 T A 2: 25,425,726 V332D probably benign Het
Gm436 A G 4: 144,670,623 Y180H possibly damaging Het
Gnas T C 2: 174,298,733 S232P probably damaging Het
Gramd4 A G 15: 86,132,905 E522G probably damaging Het
Gys1 A G 7: 45,443,546 T297A probably damaging Het
Herc4 T C 10: 63,273,525 S180P probably benign Het
Hivep3 C T 4: 120,096,238 P584S possibly damaging Het
Itpk1 G T 12: 102,675,470 probably null Het
Jmjd1c A T 10: 67,225,440 S1191C probably damaging Het
Lima1 T C 15: 99,819,684 N147S probably benign Het
Lrmp T A 6: 145,169,773 S310T probably damaging Het
Map4k5 G A 12: 69,818,492 T506I probably damaging Het
Mat1a A T 14: 41,111,034 E58V probably damaging Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Mon2 A G 10: 123,009,565 Y1413H probably damaging Het
Mpp3 C A 11: 102,018,552 probably benign Het
Mpp4 T A 1: 59,144,802 I260F probably damaging Het
Myocd C A 11: 65,200,907 G70C probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nckap5 T A 1: 126,014,630 D209V probably damaging Het
Nlrp9a A G 7: 26,564,941 K707R probably benign Het
Npr3 A G 15: 11,904,969 L224S probably benign Het
Olfr1036 T A 2: 86,075,205 L155Q probably damaging Het
Olfr1153 T A 2: 87,897,039 V280E probably damaging Het
Olfr821 A G 10: 130,033,733 S36G probably damaging Het
Otof C T 5: 30,388,654 D467N probably damaging Het
Paxx T C 2: 25,460,628 probably benign Het
Pcmt1 G A 10: 7,640,710 R179* probably null Het
Phkb T A 8: 85,970,951 V463D probably benign Het
Prkcq T C 2: 11,245,397 V175A probably damaging Het
Rasl11b T G 5: 74,196,136 I58S probably damaging Het
Rb1cc1 A T 1: 6,248,195 probably null Het
Reck T A 4: 43,913,771 probably null Het
Riox1 G T 12: 83,951,382 D231Y probably damaging Het
Rlf T A 4: 121,148,420 N1231I probably damaging Het
Rpn1 A G 6: 88,095,548 D291G possibly damaging Het
Samsn1 C T 16: 75,945,573 noncoding transcript Het
Scara5 T C 14: 65,689,800 C49R possibly damaging Het
Serpini1 A G 3: 75,614,478 D92G probably benign Het
Setdb2 A T 14: 59,419,409 L153Q probably damaging Het
Sh3rf3 C T 10: 58,813,987 T138M probably benign Het
Shkbp1 C T 7: 27,355,400 probably null Het
Slc22a29 G A 19: 8,218,343 P111S probably benign Het
Smarca1 A G X: 47,852,687 V618A probably damaging Het
Spef2 T A 15: 9,609,516 M1308L probably damaging Het
Spink5 A G 18: 43,990,708 N354S probably benign Het
Srrm2 T C 17: 23,821,491 S2370P probably damaging Het
Ssxb3 A T X: 8,588,666 I28N probably damaging Het
Sucla2 A G 14: 73,593,679 T411A probably damaging Het
Tex38 A C 4: 115,780,340 S89A probably benign Het
Tjp2 A T 19: 24,111,073 D723E probably damaging Het
Tln2 A T 9: 67,255,901 N1121K probably damaging Het
Tti1 T C 2: 158,009,046 E91G possibly damaging Het
Wdfy4 C A 14: 33,106,044 C1062F possibly damaging Het
Wiz A G 17: 32,359,372 Y389H probably damaging Het
Zcchc3 T C 2: 152,414,092 K229R probably damaging Het
Zmat3 C A 3: 32,360,982 D60Y probably damaging Het
Other mutations in Wbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Wbp2 APN 11 116081240 missense possibly damaging 0.46
R0006:Wbp2 UTSW 11 116079788 unclassified probably null
R0565:Wbp2 UTSW 11 116082385 missense possibly damaging 0.80
R1510:Wbp2 UTSW 11 116086882 missense probably benign 0.03
R1733:Wbp2 UTSW 11 116083883 missense probably benign 0.10
R1989:Wbp2 UTSW 11 116080221 critical splice donor site probably null
R2109:Wbp2 UTSW 11 116080619 nonsense probably null
R2264:Wbp2 UTSW 11 116079598 critical splice acceptor site probably null
R3079:Wbp2 UTSW 11 116079708 unclassified probably null
R4239:Wbp2 UTSW 11 116080547 unclassified probably benign
R4647:Wbp2 UTSW 11 116082381 missense probably benign 0.01
R4831:Wbp2 UTSW 11 116080637 nonsense probably null
R6146:Wbp2 UTSW 11 116083902 missense probably benign 0.07
R6367:Wbp2 UTSW 11 116083915 missense probably benign 0.36
R6455:Wbp2 UTSW 11 116079753 missense probably damaging 0.98
R6823:Wbp2 UTSW 11 116086910 missense probably benign 0.41
Z1088:Wbp2 UTSW 11 116086913 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TAATCTCGGCTAGGAAGTGAGG -3'
(R):5'- ACACCTGAGTCTGGCTTCTC -3'

Sequencing Primer
(F):5'- CTAGGAAGTGAGGCTTGGAC -3'
(R):5'- CTCCTGGGATGTTTGTTTCCAGC -3'
Posted On2014-08-25