Incidental Mutation 'R0136:Hipk3'
ID21929
Institutional Source Beutler Lab
Gene Symbol Hipk3
Ensembl Gene ENSMUSG00000027177
Gene Namehomeodomain interacting protein kinase 3
SynonymsDYRK6, FIST3
MMRRC Submission 038421-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0136 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location104426481-104494446 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104439293 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 517 (I517T)
Ref Sequence ENSEMBL: ENSMUSP00000106753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028600] [ENSMUST00000111124] [ENSMUST00000111125]
Predicted Effect probably benign
Transcript: ENSMUST00000028600
AA Change: I517T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000028600
Gene: ENSMUSG00000027177
AA Change: I517T

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 844 859 N/A INTRINSIC
low complexity region 887 906 N/A INTRINSIC
low complexity region 1093 1117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111124
AA Change: I517T

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000106753
Gene: ENSMUSG00000027177
AA Change: I517T

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 844 859 N/A INTRINSIC
low complexity region 887 906 N/A INTRINSIC
low complexity region 1093 1117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111125
AA Change: I517T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106754
Gene: ENSMUSG00000027177
AA Change: I517T

DomainStartEndE-ValueType
S_TKc 197 525 1.58e-76 SMART
low complexity region 865 880 N/A INTRINSIC
low complexity region 908 927 N/A INTRINSIC
low complexity region 1114 1138 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132622
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 89% (56/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit impaired insulin secretion and glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap4b1 T C 3: 103,809,946 M1T probably null Het
Arg2 T C 12: 79,150,006 L167P probably damaging Het
Atxn1 A G 13: 45,567,169 S417P probably damaging Het
Baz2b A G 2: 59,901,954 V1949A probably benign Het
Bcl3 A G 7: 19,809,569 V324A probably damaging Het
Btbd10 A T 7: 113,329,878 S230T possibly damaging Het
Camta1 A G 4: 151,078,969 S1479P probably damaging Het
Cd69 C T 6: 129,270,062 S64N probably benign Het
Col5a1 T C 2: 28,024,831 L153P probably damaging Het
Crat C A 2: 30,407,030 V304L probably benign Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Fau T C 19: 6,059,180 V86A possibly damaging Het
Garem1 T G 18: 21,129,991 S589R probably damaging Het
Gbp3 T G 3: 142,564,101 probably null Het
Gin1 T A 1: 97,783,016 S141R possibly damaging Het
Gtf2h1 A T 7: 46,815,416 Q419L possibly damaging Het
Hivep2 T C 10: 14,131,878 S1407P probably benign Het
Hnrnpk G T 13: 58,395,177 D211E probably benign Het
Hnrnpul2 T C 19: 8,826,801 L588P probably damaging Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Itgb1 T G 8: 128,722,854 Y585D possibly damaging Het
Kmt2d C T 15: 98,854,278 probably benign Het
Map7d1 A T 4: 126,236,631 probably null Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Med13l A G 5: 118,724,050 T353A probably benign Het
Mgat4b T C 11: 50,231,081 V143A possibly damaging Het
Mlxip T A 5: 123,442,306 W211R probably damaging Het
Morc2a T G 11: 3,685,907 probably null Het
Muc4 A T 16: 32,750,195 probably benign Het
Ndufa10 A T 1: 92,463,128 Y233* probably null Het
Nek8 C T 11: 78,171,207 S237N probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nfatc2ip A G 7: 126,391,335 S165P probably benign Het
Nsd2 A G 5: 33,855,536 K404E possibly damaging Het
Nsd3 G T 8: 25,659,854 E352* probably null Het
Nudt9 A G 5: 104,047,106 T23A probably benign Het
Olfr394 T C 11: 73,887,785 M196V probably benign Het
Olfr394 C T 11: 73,887,830 V181I probably benign Het
Olfr983 A G 9: 40,092,019 *312Q probably null Het
Patj C A 4: 98,667,648 Q297K probably damaging Het
Pelo A T 13: 115,088,903 C40* probably null Het
Pnpla3 G A 15: 84,174,478 probably null Het
Pramel1 C A 4: 143,397,446 N230K probably damaging Het
Psg20 A C 7: 18,682,507 L228R probably damaging Het
Rsph10b T C 5: 143,959,821 F44L probably benign Het
Sept2 G A 1: 93,507,050 G358R possibly damaging Het
Slamf7 G A 1: 171,648,931 probably benign Het
Slc12a8 A G 16: 33,608,213 D297G probably damaging Het
Slc17a5 G A 9: 78,578,674 A43V probably damaging Het
Slc22a1 A T 17: 12,662,596 F335L probably benign Het
Slc26a5 T C 5: 21,834,347 N216S probably damaging Het
Snrnp27 T C 6: 86,676,205 S144G probably benign Het
Spata20 T A 11: 94,480,609 D643V probably damaging Het
Spata24 T C 18: 35,660,462 K99R probably damaging Het
Taar5 A G 10: 23,971,709 Y335C probably damaging Het
Tpr A G 1: 150,430,595 H1540R probably benign Het
Vmn1r27 A G 6: 58,215,719 F100S possibly damaging Het
Vmn2r37 A T 7: 9,217,783 Y360* probably null Het
Ybx1 C A 4: 119,282,354 R36L possibly damaging Het
Zfp369 A G 13: 65,297,202 K720E probably benign Het
Zfp599 A G 9: 22,249,742 S376P probably benign Het
Zic2 A G 14: 122,476,541 E289G probably damaging Het
Zzef1 T C 11: 72,821,851 V199A probably benign Het
Other mutations in Hipk3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Hipk3 APN 2 104430231 missense possibly damaging 0.52
IGL00937:Hipk3 APN 2 104433172 missense possibly damaging 0.82
IGL01719:Hipk3 APN 2 104437089 missense possibly damaging 0.78
IGL01802:Hipk3 APN 2 104471853 splice site probably benign
IGL01932:Hipk3 APN 2 104470981 missense probably damaging 1.00
IGL02089:Hipk3 APN 2 104431379 missense probably damaging 1.00
IGL02522:Hipk3 APN 2 104471331 missense probably damaging 1.00
IGL02525:Hipk3 APN 2 104471412 missense probably damaging 1.00
IGL02959:Hipk3 APN 2 104471259 missense probably damaging 1.00
IGL02986:Hipk3 APN 2 104433741 missense probably damaging 1.00
R0277:Hipk3 UTSW 2 104441248 missense probably damaging 1.00
R0308:Hipk3 UTSW 2 104433207 missense probably damaging 0.99
R0367:Hipk3 UTSW 2 104431249 nonsense probably null
R0597:Hipk3 UTSW 2 104433637 missense possibly damaging 0.94
R1079:Hipk3 UTSW 2 104471698 missense probably benign 0.00
R1171:Hipk3 UTSW 2 104471676 missense probably benign 0.02
R1244:Hipk3 UTSW 2 104433256 missense probably damaging 1.00
R1509:Hipk3 UTSW 2 104441262 missense probably benign 0.01
R1616:Hipk3 UTSW 2 104433745 nonsense probably null
R1893:Hipk3 UTSW 2 104433256 missense probably damaging 1.00
R1938:Hipk3 UTSW 2 104430188 missense possibly damaging 0.89
R1969:Hipk3 UTSW 2 104433841 missense probably damaging 1.00
R1975:Hipk3 UTSW 2 104471173 missense probably benign 0.00
R1985:Hipk3 UTSW 2 104434435 missense probably benign 0.16
R2105:Hipk3 UTSW 2 104439392 missense probably damaging 0.97
R2422:Hipk3 UTSW 2 104471485 missense probably benign 0.01
R3028:Hipk3 UTSW 2 104433790 missense probably benign
R3747:Hipk3 UTSW 2 104441283 nonsense probably null
R3923:Hipk3 UTSW 2 104470762 missense probably damaging 1.00
R4320:Hipk3 UTSW 2 104446571 missense probably damaging 1.00
R4321:Hipk3 UTSW 2 104446571 missense probably damaging 1.00
R4322:Hipk3 UTSW 2 104446571 missense probably damaging 1.00
R4323:Hipk3 UTSW 2 104446571 missense probably damaging 1.00
R4324:Hipk3 UTSW 2 104446571 missense probably damaging 1.00
R4595:Hipk3 UTSW 2 104441277 missense probably benign 0.01
R4604:Hipk3 UTSW 2 104439329 missense probably damaging 1.00
R4657:Hipk3 UTSW 2 104433759 missense probably benign 0.00
R5193:Hipk3 UTSW 2 104430000 missense possibly damaging 0.94
R5769:Hipk3 UTSW 2 104434953 missense possibly damaging 0.69
R5843:Hipk3 UTSW 2 104440224 missense possibly damaging 0.65
R5906:Hipk3 UTSW 2 104471808 missense probably damaging 1.00
R5976:Hipk3 UTSW 2 104471184 missense probably damaging 1.00
R5991:Hipk3 UTSW 2 104437983 missense probably damaging 1.00
R6214:Hipk3 UTSW 2 104433741 missense probably damaging 1.00
R6215:Hipk3 UTSW 2 104433741 missense probably damaging 1.00
R6285:Hipk3 UTSW 2 104471425 missense probably damaging 1.00
R6523:Hipk3 UTSW 2 104439408 missense possibly damaging 0.50
R6713:Hipk3 UTSW 2 104446571 missense probably damaging 1.00
R7381:Hipk3 UTSW 2 104439351 missense probably damaging 0.99
R7517:Hipk3 UTSW 2 104434714 missense probably benign 0.00
X0021:Hipk3 UTSW 2 104441366 critical splice acceptor site probably null
Z1088:Hipk3 UTSW 2 104434629 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAGGAACTCCTTGCTCCCTCAC -3'
(R):5'- TGCTCAGAGACATATCCATTTGCATAGC -3'

Sequencing Primer
(F):5'- agtctatgcaacctcagcc -3'
(R):5'- cagagacagacagacagacac -3'
Posted On2013-04-12