Incidental Mutation 'R2008:Spef2'
ID219296
Institutional Source Beutler Lab
Gene Symbol Spef2
Ensembl Gene ENSMUSG00000072663
Gene Namesperm flagellar 2
SynonymsC230086A09Rik
MMRRC Submission 040017-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R2008 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location9578193-9748868 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 9713185 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 367 (K367R)
Ref Sequence ENSEMBL: ENSMUSP00000124222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041840] [ENSMUST00000159093] [ENSMUST00000159368] [ENSMUST00000160236] [ENSMUST00000162780] [ENSMUST00000208854]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041840
AA Change: K367R

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035762
Gene: ENSMUSG00000072663
AA Change: K367R

DomainStartEndE-ValueType
Pfam:DUF1042 5 161 2.8e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 600 829 5.9e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000159093
AA Change: K424R

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124891
Gene: ENSMUSG00000072663
AA Change: K424R

DomainStartEndE-ValueType
Pfam:DUF1042 5 166 3.5e-57 PFAM
coiled coil region 167 205 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
coiled coil region 228 260 N/A INTRINSIC
low complexity region 304 313 N/A INTRINSIC
coiled coil region 369 402 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159288
AA Change: K367R

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125336
Gene: ENSMUSG00000072663
AA Change: K367R

DomainStartEndE-ValueType
Pfam:CH_2 5 102 3.1e-25 PFAM
low complexity region 106 115 N/A INTRINSIC
low complexity region 137 148 N/A INTRINSIC
low complexity region 151 163 N/A INTRINSIC
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 602 789 8.8e-11 PFAM
low complexity region 819 855 N/A INTRINSIC
low complexity region 899 907 N/A INTRINSIC
low complexity region 1201 1221 N/A INTRINSIC
low complexity region 1264 1278 N/A INTRINSIC
low complexity region 1359 1369 N/A INTRINSIC
SCOP:d1rec__ 1378 1530 3e-3 SMART
low complexity region 1605 1624 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000159368
AA Change: K367R

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124723
Gene: ENSMUSG00000072663
AA Change: K367R

DomainStartEndE-ValueType
Pfam:DUF1042 5 162 1.4e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160236
AA Change: K367R

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124222
Gene: ENSMUSG00000072663
AA Change: K367R

DomainStartEndE-ValueType
Pfam:DUF1042 5 160 4.6e-59 PFAM
coiled coil region 171 203 N/A INTRINSIC
low complexity region 247 256 N/A INTRINSIC
coiled coil region 312 345 N/A INTRINSIC
Pfam:ADK 600 787 3.7e-10 PFAM
low complexity region 819 855 N/A INTRINSIC
low complexity region 899 907 N/A INTRINSIC
low complexity region 1201 1225 N/A INTRINSIC
low complexity region 1254 1268 N/A INTRINSIC
low complexity region 1349 1359 N/A INTRINSIC
SCOP:d1rec__ 1368 1520 3e-3 SMART
low complexity region 1595 1614 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000162780
AA Change: K424R

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124393
Gene: ENSMUSG00000072663
AA Change: K424R

DomainStartEndE-ValueType
Pfam:DUF1042 5 164 1.1e-57 PFAM
coiled coil region 167 205 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
coiled coil region 228 260 N/A INTRINSIC
low complexity region 304 313 N/A INTRINSIC
coiled coil region 369 402 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000208854
AA Change: K367R

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit male infertility due to oligospermia and abnormal spermatogenesis, hydroencephaly, sinusitis, and background-dependent lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik C T 5: 98,737,702 T156I possibly damaging Het
1700061G19Rik A G 17: 56,886,478 N608S probably benign Het
2510039O18Rik T A 4: 147,941,577 C185S probably benign Het
Actl6b T A 5: 137,569,330 S409T probably damaging Het
Adgrf2 T C 17: 42,710,122 T604A probably damaging Het
Adprhl2 T A 4: 126,317,344 D260V probably benign Het
Akap9 A G 5: 3,960,131 E296G possibly damaging Het
Alg5 A G 3: 54,746,473 Y210C possibly damaging Het
Aoc1 T C 6: 48,905,897 W236R probably damaging Het
Atp11b A G 3: 35,855,122 D1155G probably damaging Het
Atp2c1 T A 9: 105,432,726 T551S probably benign Het
Atp7b A T 8: 22,027,980 C281S probably damaging Het
Bmp1 C T 14: 70,492,466 C466Y probably damaging Het
Cabin1 T C 10: 75,734,976 probably null Het
Capn9 T G 8: 124,591,685 C97G probably damaging Het
Cbfa2t3 A G 8: 122,643,293 V147A probably damaging Het
Ccdc83 T A 7: 90,244,141 Y136F probably damaging Het
Cdh6 C A 15: 13,051,476 R357L possibly damaging Het
Celf1 A T 2: 91,010,408 N367I probably damaging Het
Cep350 T C 1: 155,914,721 I1363V probably benign Het
Colec12 T A 18: 9,874,813 D696E probably benign Het
Ctbp1 C T 5: 33,250,986 E138K probably damaging Het
Cyp4a10 T C 4: 115,525,392 I293T probably damaging Het
D430042O09Rik C G 7: 125,860,566 H1189D probably damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dctn1 C T 6: 83,189,956 T263I probably damaging Het
Ddx49 A T 8: 70,295,444 V317E probably damaging Het
Edil3 G A 13: 88,944,953 probably null Het
Egflam A T 15: 7,237,804 V700E possibly damaging Het
Fam168b A G 1: 34,819,865 probably null Het
Gigyf2 T G 1: 87,374,113 probably null Het
Gm5346 A T 8: 43,627,037 V50D probably benign Het
Heatr4 A G 12: 83,979,740 S248P probably benign Het
Hist1h1c C G 13: 23,739,409 S187R probably benign Het
Hoxd1 A T 2: 74,764,180 I260F possibly damaging Het
Hsd3b3 A T 3: 98,742,092 L305Q probably damaging Het
Itch T A 2: 155,210,459 C660S possibly damaging Het
Ivd A T 2: 118,871,500 I138F probably benign Het
Lcn4 G T 2: 26,671,216 Q18K possibly damaging Het
Mapkbp1 T C 2: 120,012,665 Y192H probably damaging Het
Mn1 T C 5: 111,418,857 L231P probably damaging Het
Morc1 A G 16: 48,565,646 D544G probably benign Het
Mthfd1 C A 12: 76,297,519 T331K probably damaging Het
Myo18b T A 5: 112,873,557 Y546F probably benign Het
Nod1 T C 6: 54,939,325 Y129C probably damaging Het
Nprl3 A G 11: 32,232,973 V563A probably damaging Het
Olfr1253 A T 2: 89,752,073 C252S possibly damaging Het
Olfr46 T C 7: 140,610,585 Y140H probably damaging Het
Olfr497 T C 7: 108,423,182 F204L probably benign Het
Olfr904 T C 9: 38,464,241 S67P probably damaging Het
Olfr998 A G 2: 85,591,422 N294S probably damaging Het
Orc3 T A 4: 34,611,049 probably null Het
Otog T C 7: 46,264,074 V777A probably benign Het
Pbxip1 G T 3: 89,448,713 V711L probably benign Het
Pcdhb16 A G 18: 37,478,263 D92G probably damaging Het
Phkb T A 8: 86,056,467 M964K probably damaging Het
Pitpnm2 T A 5: 124,152,621 M1L probably damaging Het
Pkhd1 A G 1: 20,199,459 V3287A probably damaging Het
Polq T A 16: 37,062,482 H1669Q probably damaging Het
Ppp4r4 T C 12: 103,585,757 S195P probably damaging Het
Prdm2 T C 4: 143,134,947 Y591C probably damaging Het
Rgsl1 T A 1: 153,825,905 T268S possibly damaging Het
Scd2 A T 19: 44,303,171 T350S probably benign Het
Scn7a T A 2: 66,687,747 Q1040L possibly damaging Het
Sdhb T A 4: 140,979,029 L259Q probably damaging Het
Senp6 A G 9: 80,126,398 H701R probably damaging Het
Slc41a2 C T 10: 83,304,303 probably null Het
Slx4 T C 16: 3,979,921 D1533G probably damaging Het
Sstr3 G A 15: 78,540,511 T12M probably benign Het
Synj2 G T 17: 5,996,946 E20D probably damaging Het
Tchh G T 3: 93,445,974 R907L unknown Het
Thsd1 A G 8: 22,259,231 E645G probably benign Het
Tmem176b A T 6: 48,835,449 M194K probably damaging Het
Tmprss11f T C 5: 86,591,406 probably null Het
Trim44 G A 2: 102,400,377 probably benign Het
Triml1 T A 8: 43,130,605 R320W probably damaging Het
Trmt6 A T 2: 132,806,909 C401* probably null Het
Trpv5 T C 6: 41,659,728 probably null Het
V1rd19 T A 7: 24,003,301 L64* probably null Het
Vmn1r216 A T 13: 23,099,491 R115W probably damaging Het
Vmn2r58 T C 7: 41,860,500 N551S probably damaging Het
Vmn2r77 T C 7: 86,801,713 V269A probably benign Het
Vps13d A T 4: 145,155,243 V1254D probably benign Het
Xpr1 T C 1: 155,281,029 probably null Het
Zan T A 5: 137,452,450 T1622S unknown Het
Zfp112 T C 7: 24,126,751 Y715H probably damaging Het
Zfp750 G A 11: 121,513,125 P308L possibly damaging Het
Other mutations in Spef2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Spef2 APN 15 9740535 missense probably damaging 1.00
IGL00886:Spef2 APN 15 9663095 missense probably damaging 1.00
IGL01409:Spef2 APN 15 9716413 missense probably damaging 1.00
IGL01413:Spef2 APN 15 9676290 missense probably benign 0.16
IGL01474:Spef2 APN 15 9663158 missense probably benign 0.00
IGL01603:Spef2 APN 15 9704380 missense probably damaging 0.99
IGL02320:Spef2 APN 15 9717576 missense probably damaging 0.99
IGL02570:Spef2 APN 15 9717498 nonsense probably null
IGL02605:Spef2 APN 15 9725152 missense probably damaging 0.99
IGL02890:Spef2 APN 15 9748767 start codon destroyed probably null 1.00
IGL02904:Spef2 APN 15 9679346 missense probably damaging 1.00
IGL02942:Spef2 APN 15 9668874 missense possibly damaging 0.71
IGL02953:Spef2 APN 15 9713243 missense possibly damaging 0.82
IGL02965:Spef2 APN 15 9725106 splice site probably benign
IGL03263:Spef2 APN 15 9667219 missense possibly damaging 0.72
IGL03302:Spef2 APN 15 9676380 missense probably benign 0.01
R0101:Spef2 UTSW 15 9713108 missense probably damaging 1.00
R0101:Spef2 UTSW 15 9713108 missense probably damaging 1.00
R0183:Spef2 UTSW 15 9716359 missense possibly damaging 0.70
R0386:Spef2 UTSW 15 9584062 missense probably damaging 1.00
R0511:Spef2 UTSW 15 9583984 critical splice donor site probably null
R0617:Spef2 UTSW 15 9592758 missense probably damaging 1.00
R0655:Spef2 UTSW 15 9626131 missense possibly damaging 0.96
R0829:Spef2 UTSW 15 9687813 missense probably benign 0.10
R0908:Spef2 UTSW 15 9614195 splice site probably null
R0939:Spef2 UTSW 15 9704550 splice site probably null
R0973:Spef2 UTSW 15 9716396 missense probably damaging 1.00
R1371:Spef2 UTSW 15 9725108 splice site probably benign
R1392:Spef2 UTSW 15 9647263 missense probably benign 0.15
R1392:Spef2 UTSW 15 9647263 missense probably benign 0.15
R1428:Spef2 UTSW 15 9596707 unclassified probably benign
R1518:Spef2 UTSW 15 9667230 missense probably damaging 1.00
R1585:Spef2 UTSW 15 9596574 missense probably damaging 1.00
R1654:Spef2 UTSW 15 9634652 missense probably damaging 0.99
R1723:Spef2 UTSW 15 9614209 missense probably damaging 1.00
R1757:Spef2 UTSW 15 9717482 missense probably damaging 1.00
R1812:Spef2 UTSW 15 9679349 missense probably damaging 1.00
R1817:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1818:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1873:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1875:Spef2 UTSW 15 9584108 missense probably damaging 0.96
R1875:Spef2 UTSW 15 9597401 missense possibly damaging 0.78
R1897:Spef2 UTSW 15 9729654 nonsense probably null
R1901:Spef2 UTSW 15 9607377 missense probably damaging 1.00
R1902:Spef2 UTSW 15 9607377 missense probably damaging 1.00
R1943:Spef2 UTSW 15 9663194 missense possibly damaging 0.76
R1968:Spef2 UTSW 15 9609516 missense probably damaging 1.00
R1973:Spef2 UTSW 15 9663066 makesense probably null
R1998:Spef2 UTSW 15 9668903 critical splice acceptor site probably null
R1999:Spef2 UTSW 15 9668903 critical splice acceptor site probably null
R2111:Spef2 UTSW 15 9589573 missense probably damaging 1.00
R2127:Spef2 UTSW 15 9729661 missense possibly damaging 0.53
R2405:Spef2 UTSW 15 9626034 nonsense probably null
R2517:Spef2 UTSW 15 9725197 missense possibly damaging 0.93
R2889:Spef2 UTSW 15 9630613 missense probably damaging 0.99
R2988:Spef2 UTSW 15 9682623 missense probably benign 0.43
R3792:Spef2 UTSW 15 9704536 missense probably damaging 1.00
R4154:Spef2 UTSW 15 9626021 missense probably benign 0.13
R4159:Spef2 UTSW 15 9676321 missense probably damaging 1.00
R4199:Spef2 UTSW 15 9667280 missense probably damaging 1.00
R4320:Spef2 UTSW 15 9679343 missense possibly damaging 0.93
R4321:Spef2 UTSW 15 9679343 missense possibly damaging 0.93
R4568:Spef2 UTSW 15 9647217 missense probably damaging 1.00
R4625:Spef2 UTSW 15 9647438 missense probably damaging 1.00
R4669:Spef2 UTSW 15 9676373 missense probably benign 0.42
R4684:Spef2 UTSW 15 9647490 missense probably benign 0.44
R4761:Spef2 UTSW 15 9652954 missense probably damaging 1.00
R4839:Spef2 UTSW 15 9713178 nonsense probably null
R5004:Spef2 UTSW 15 9578327 missense probably benign 0.02
R5157:Spef2 UTSW 15 9668791 nonsense probably null
R5230:Spef2 UTSW 15 9667230 missense possibly damaging 0.62
R5315:Spef2 UTSW 15 9596691 missense probably damaging 0.98
R5400:Spef2 UTSW 15 9614281 missense probably damaging 1.00
R5591:Spef2 UTSW 15 9583836 missense probably benign 0.02
R5599:Spef2 UTSW 15 9729703 missense possibly damaging 0.53
R5605:Spef2 UTSW 15 9609520 missense probably damaging 0.96
R5787:Spef2 UTSW 15 9748726 missense possibly damaging 0.91
R5939:Spef2 UTSW 15 9614215 missense probably benign 0.16
R6177:Spef2 UTSW 15 9727532 missense possibly damaging 0.89
R6641:Spef2 UTSW 15 9625973 missense probably damaging 1.00
R6665:Spef2 UTSW 15 9600518 critical splice donor site probably null
R6944:Spef2 UTSW 15 9592749 missense probably damaging 1.00
R6956:Spef2 UTSW 15 9684935 missense probably damaging 1.00
R6968:Spef2 UTSW 15 9597340 missense probably benign 0.02
R7089:Spef2 UTSW 15 9725171 missense probably damaging 1.00
R7117:Spef2 UTSW 15 9729838 missense probably damaging 1.00
R7161:Spef2 UTSW 15 9717603 missense probably benign 0.29
R7223:Spef2 UTSW 15 9601640 missense unknown
R7263:Spef2 UTSW 15 9653012 synonymous probably null
R7270:Spef2 UTSW 15 9599980 critical splice donor site probably null
R7303:Spef2 UTSW 15 9647490 missense possibly damaging 0.92
R7369:Spef2 UTSW 15 9584207 missense probably benign 0.02
R7464:Spef2 UTSW 15 9740585 missense probably benign 0.23
R7498:Spef2 UTSW 15 9727539 missense probably benign
R7587:Spef2 UTSW 15 9713219 missense probably damaging 1.00
R7748:Spef2 UTSW 15 9652945 missense probably damaging 0.98
R7772:Spef2 UTSW 15 9704481 missense probably damaging 0.99
R7838:Spef2 UTSW 15 9609551 missense possibly damaging 0.53
R7854:Spef2 UTSW 15 9596644 missense possibly damaging 0.77
R7855:Spef2 UTSW 15 9687895 missense possibly damaging 0.53
R7889:Spef2 UTSW 15 9717563 missense probably damaging 1.00
R7921:Spef2 UTSW 15 9609551 missense possibly damaging 0.53
R7937:Spef2 UTSW 15 9596644 missense possibly damaging 0.77
R7938:Spef2 UTSW 15 9687895 missense possibly damaging 0.53
R7972:Spef2 UTSW 15 9717563 missense probably damaging 1.00
X0025:Spef2 UTSW 15 9596622 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAATTGTGTCTGCTGTGCC -3'
(R):5'- TGTCTTTGCTGTCATACGCAATAC -3'

Sequencing Primer
(F):5'- CTGCTGTGCCTTTCGAGTATG -3'
(R):5'- GCTGTCATACGCAATACTTAGAG -3'
Posted On2014-08-25