Incidental Mutation 'R1968:Setdb2'
ID219300
Institutional Source Beutler Lab
Gene Symbol Setdb2
Ensembl Gene ENSMUSG00000071350
Gene NameSET domain, bifurcated 2
SynonymsKMT1F, LOC239122
MMRRC Submission 039981-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.658) question?
Stock #R1968 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location59402009-59440884 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 59419409 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 153 (L153Q)
Ref Sequence ENSEMBL: ENSMUSP00000124696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095775] [ENSMUST00000111253] [ENSMUST00000161459]
Predicted Effect probably damaging
Transcript: ENSMUST00000095775
AA Change: L169Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093450
Gene: ENSMUSG00000071350
AA Change: L169Q

DomainStartEndE-ValueType
Pfam:MBD 164 236 3.4e-10 PFAM
Pfam:Pre-SET 250 362 1.7e-17 PFAM
SET 370 694 9.33e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111253
Predicted Effect probably damaging
Transcript: ENSMUST00000161459
AA Change: L153Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124696
Gene: ENSMUSG00000071350
AA Change: L153Q

DomainStartEndE-ValueType
Pfam:MBD 148 220 2.7e-9 PFAM
Pfam:Pre-SET 233 346 1.3e-19 PFAM
SET 354 678 9.33e-32 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161959
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that contain a methyl-CpG-binding domain (MBD) and a SET domain and function as histone methyltransferases. This protein is recruited to heterochromatin and plays a role in the regulation of chromosome segregation. This region is commonly deleted in chronic lymphocytic leukemia. Naturally-occuring readthrough transcription occurs from this gene to the downstream PHF11 (PHD finger protein 11) gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit altered response to infection and improved patology following superinfection of influenza virus-infected mice with S. pneumonia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,322,199 L528Q probably damaging Het
Adam18 T A 8: 24,646,447 T353S probably benign Het
Aldh1a3 A G 7: 66,411,500 probably null Het
Aldh3b2 T A 19: 3,980,705 M390K probably benign Het
Arhgap45 T C 10: 80,027,702 I793T probably damaging Het
Arsb A G 13: 93,807,559 M253V probably benign Het
Atcay T C 10: 81,212,478 D258G possibly damaging Het
Atf1 G T 15: 100,254,514 probably null Het
Atp1a4 C T 1: 172,240,164 E511K probably benign Het
Atp8a1 A G 5: 67,667,657 V777A probably benign Het
Baz1a T C 12: 54,900,337 T1173A possibly damaging Het
Bdh2 A T 3: 135,285,609 D15V probably benign Het
Cacna1e T C 1: 154,700,494 Y69C probably damaging Het
Caskin2 A G 11: 115,803,614 L387P probably benign Het
Cat T C 2: 103,484,989 E17G probably benign Het
Ccdc15 T C 9: 37,347,795 I54M probably benign Het
Cdhr1 T G 14: 37,079,725 I754L probably benign Het
Cep120 G A 18: 53,723,241 T368I probably benign Het
Cep126 C A 9: 8,100,908 D542Y probably damaging Het
Cep135 T C 5: 76,624,747 S660P possibly damaging Het
Cfap70 A T 14: 20,420,811 S455R possibly damaging Het
Chd8 A G 14: 52,220,993 M886T probably damaging Het
Ckap5 T C 2: 91,586,343 S1098P probably benign Het
Clec4e A T 6: 123,283,574 I204N probably damaging Het
Cntnap5c G A 17: 58,359,296 R1107H probably damaging Het
Cramp1l T C 17: 24,964,939 D1234G probably damaging Het
Csf1r A T 18: 61,112,795 I275L probably benign Het
Cyp27a1 A G 1: 74,737,276 E457G probably benign Het
Cyp2d11 T C 15: 82,389,548 T410A probably benign Het
Cyp2d22 G C 15: 82,373,172 T264S probably benign Het
Cyr61 T C 3: 145,648,210 Y275C probably damaging Het
Daam2 G A 17: 49,483,060 R390W probably damaging Het
Decr2 T C 17: 26,083,079 S226G probably benign Het
Dennd6b T C 15: 89,190,341 D91G possibly damaging Het
Dglucy T C 12: 100,859,644 V515A possibly damaging Het
Dlg5 A T 14: 24,164,119 L734* probably null Het
Dopey2 A G 16: 93,782,419 N1690D probably damaging Het
Exoc5 A G 14: 49,034,890 Y356H probably benign Het
Fut7 T A 2: 25,425,726 V332D probably benign Het
Gm436 A G 4: 144,670,623 Y180H possibly damaging Het
Gnas T C 2: 174,298,733 S232P probably damaging Het
Gramd4 A G 15: 86,132,905 E522G probably damaging Het
Gys1 A G 7: 45,443,546 T297A probably damaging Het
Herc4 T C 10: 63,273,525 S180P probably benign Het
Hivep3 C T 4: 120,096,238 P584S possibly damaging Het
Itpk1 G T 12: 102,675,470 probably null Het
Jmjd1c A T 10: 67,225,440 S1191C probably damaging Het
Lima1 T C 15: 99,819,684 N147S probably benign Het
Lrmp T A 6: 145,169,773 S310T probably damaging Het
Map4k5 G A 12: 69,818,492 T506I probably damaging Het
Mat1a A T 14: 41,111,034 E58V probably damaging Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Mon2 A G 10: 123,009,565 Y1413H probably damaging Het
Mpp3 C A 11: 102,018,552 probably benign Het
Mpp4 T A 1: 59,144,802 I260F probably damaging Het
Myocd C A 11: 65,200,907 G70C probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nckap5 T A 1: 126,014,630 D209V probably damaging Het
Nlrp9a A G 7: 26,564,941 K707R probably benign Het
Npr3 A G 15: 11,904,969 L224S probably benign Het
Olfr1036 T A 2: 86,075,205 L155Q probably damaging Het
Olfr1153 T A 2: 87,897,039 V280E probably damaging Het
Olfr821 A G 10: 130,033,733 S36G probably damaging Het
Otof C T 5: 30,388,654 D467N probably damaging Het
Paxx T C 2: 25,460,628 probably benign Het
Pcmt1 G A 10: 7,640,710 R179* probably null Het
Phkb T A 8: 85,970,951 V463D probably benign Het
Prkcq T C 2: 11,245,397 V175A probably damaging Het
Rasl11b T G 5: 74,196,136 I58S probably damaging Het
Rb1cc1 A T 1: 6,248,195 probably null Het
Reck T A 4: 43,913,771 probably null Het
Riox1 G T 12: 83,951,382 D231Y probably damaging Het
Rlf T A 4: 121,148,420 N1231I probably damaging Het
Rpn1 A G 6: 88,095,548 D291G possibly damaging Het
Samsn1 C T 16: 75,945,573 noncoding transcript Het
Scara5 T C 14: 65,689,800 C49R possibly damaging Het
Serpini1 A G 3: 75,614,478 D92G probably benign Het
Sh3rf3 C T 10: 58,813,987 T138M probably benign Het
Shkbp1 C T 7: 27,355,400 probably null Het
Slc22a29 G A 19: 8,218,343 P111S probably benign Het
Smarca1 A G X: 47,852,687 V618A probably damaging Het
Spef2 T A 15: 9,609,516 M1308L probably damaging Het
Spink5 A G 18: 43,990,708 N354S probably benign Het
Srrm2 T C 17: 23,821,491 S2370P probably damaging Het
Ssxb3 A T X: 8,588,666 I28N probably damaging Het
Sucla2 A G 14: 73,593,679 T411A probably damaging Het
Tex38 A C 4: 115,780,340 S89A probably benign Het
Tjp2 A T 19: 24,111,073 D723E probably damaging Het
Tln2 A T 9: 67,255,901 N1121K probably damaging Het
Tti1 T C 2: 158,009,046 E91G possibly damaging Het
Wbp2 A T 11: 116,082,365 M72K possibly damaging Het
Wdfy4 C A 14: 33,106,044 C1062F possibly damaging Het
Wiz A G 17: 32,359,372 Y389H probably damaging Het
Zcchc3 T C 2: 152,414,092 K229R probably damaging Het
Zmat3 C A 3: 32,360,982 D60Y probably damaging Het
Other mutations in Setdb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Setdb2 APN 14 59415792 missense probably damaging 1.00
IGL01695:Setdb2 APN 14 59402293 utr 3 prime probably benign
IGL01720:Setdb2 APN 14 59423436 missense possibly damaging 0.76
IGL02003:Setdb2 APN 14 59413490 missense probably damaging 0.98
IGL02023:Setdb2 APN 14 59431158 missense probably damaging 1.00
IGL02108:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02113:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02114:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02115:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02116:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02117:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02141:Setdb2 APN 14 59402315 missense probably damaging 1.00
IGL02148:Setdb2 APN 14 59402315 missense probably damaging 1.00
R0419:Setdb2 UTSW 14 59406744 splice site probably null
R0610:Setdb2 UTSW 14 59417470 missense possibly damaging 0.55
R0636:Setdb2 UTSW 14 59406704 missense probably benign 0.40
R0890:Setdb2 UTSW 14 59419220 missense possibly damaging 0.89
R0931:Setdb2 UTSW 14 59423496 splice site probably benign
R1355:Setdb2 UTSW 14 59417441 missense probably damaging 1.00
R1553:Setdb2 UTSW 14 59417485 missense probably benign 0.04
R2472:Setdb2 UTSW 14 59419454 missense possibly damaging 0.49
R2894:Setdb2 UTSW 14 59426467 missense probably benign 0.00
R3919:Setdb2 UTSW 14 59419167 missense probably damaging 1.00
R4609:Setdb2 UTSW 14 59415704 missense probably damaging 1.00
R4629:Setdb2 UTSW 14 59409359 missense probably benign 0.13
R4816:Setdb2 UTSW 14 59413646 missense probably benign 0.05
R4864:Setdb2 UTSW 14 59409266 missense probably benign 0.01
R4951:Setdb2 UTSW 14 59402303 missense possibly damaging 0.72
R5040:Setdb2 UTSW 14 59415707 missense probably damaging 0.99
R5245:Setdb2 UTSW 14 59426494 missense probably null 0.00
R5358:Setdb2 UTSW 14 59409436 missense probably benign 0.17
R5656:Setdb2 UTSW 14 59419118 missense probably damaging 1.00
R5705:Setdb2 UTSW 14 59423365 missense possibly damaging 0.80
R6103:Setdb2 UTSW 14 59409532 splice site probably null
R6106:Setdb2 UTSW 14 59423449 nonsense probably null
R6388:Setdb2 UTSW 14 59424697 missense probably benign
R6431:Setdb2 UTSW 14 59419056 missense probably damaging 1.00
R6494:Setdb2 UTSW 14 59402414 missense probably benign 0.12
R6971:Setdb2 UTSW 14 59415740 missense probably damaging 1.00
R7442:Setdb2 UTSW 14 59419251 missense probably damaging 0.99
R7444:Setdb2 UTSW 14 59423345 nonsense probably null
R7759:Setdb2 UTSW 14 59419364 missense probably damaging 1.00
R8021:Setdb2 UTSW 14 59423384 nonsense probably null
R8039:Setdb2 UTSW 14 59402375 missense probably damaging 1.00
R8261:Setdb2 UTSW 14 59413692 splice site probably benign
R8393:Setdb2 UTSW 14 59412731 missense probably benign 0.04
R8513:Setdb2 UTSW 14 59402390 missense probably damaging 1.00
R8700:Setdb2 UTSW 14 59417439 missense probably damaging 1.00
R8707:Setdb2 UTSW 14 59423458 nonsense probably null
X0017:Setdb2 UTSW 14 59419468 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGATTCCGAGTCAACTGG -3'
(R):5'- TAATTGTCACCTTAGTGTGCAGTG -3'

Sequencing Primer
(F):5'- AGTATTGAAAGAGAAGTTGTCTGTG -3'
(R):5'- AGTGTGCAGTGTTTTTAAAAATGAAG -3'
Posted On2014-08-25