Incidental Mutation 'R2008:Polq'
ID219304
Institutional Source Beutler Lab
Gene Symbol Polq
Ensembl Gene ENSMUSG00000034206
Gene Namepolymerase (DNA directed), theta
SynonymsA430110D14Rik
MMRRC Submission 040017-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.342) question?
Stock #R2008 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location37011786-37095417 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37062482 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1669 (H1669Q)
Ref Sequence ENSEMBL: ENSMUSP00000059757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054034] [ENSMUST00000071452] [ENSMUST00000182946] [ENSMUST00000183112]
Predicted Effect probably damaging
Transcript: ENSMUST00000054034
AA Change: H1669Q

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000059757
Gene: ENSMUSG00000034206
AA Change: H1669Q

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
DEXDc 87 298 4.09e-18 SMART
HELICc 398 484 4.02e-17 SMART
Blast:DEXDc 485 550 2e-25 BLAST
low complexity region 609 626 N/A INTRINSIC
PDB:2ZJA|A 712 826 5e-9 PDB
low complexity region 845 852 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
low complexity region 1126 1149 N/A INTRINSIC
low complexity region 1813 1822 N/A INTRINSIC
POLAc 2265 2504 3.3e-101 SMART
low complexity region 2521 2531 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071452
AA Change: H1390Q

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000071396
Gene: ENSMUSG00000034206
AA Change: H1390Q

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 216 5.9e-12 PFAM
low complexity region 330 347 N/A INTRINSIC
PDB:2ZJA|A 433 547 5e-9 PDB
low complexity region 566 573 N/A INTRINSIC
low complexity region 619 632 N/A INTRINSIC
low complexity region 847 870 N/A INTRINSIC
low complexity region 1534 1543 N/A INTRINSIC
POLAc 1986 2225 3.3e-101 SMART
low complexity region 2242 2252 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182622
Predicted Effect probably benign
Transcript: ENSMUST00000182946
SMART Domains Protein: ENSMUSP00000138685
Gene: ENSMUSG00000034206

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 164 1.3e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183112
SMART Domains Protein: ENSMUSP00000138648
Gene: ENSMUSG00000034206

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
low complexity region 38 55 N/A INTRINSIC
Pfam:DEAD 92 164 1.3e-9 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Animals carrying a homozygous mutation at this locus display elevated levels of chromosomal damage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik C T 5: 98,737,702 T156I possibly damaging Het
1700061G19Rik A G 17: 56,886,478 N608S probably benign Het
2510039O18Rik T A 4: 147,941,577 C185S probably benign Het
Actl6b T A 5: 137,569,330 S409T probably damaging Het
Adgrf2 T C 17: 42,710,122 T604A probably damaging Het
Adprhl2 T A 4: 126,317,344 D260V probably benign Het
Akap9 A G 5: 3,960,131 E296G possibly damaging Het
Alg5 A G 3: 54,746,473 Y210C possibly damaging Het
Aoc1 T C 6: 48,905,897 W236R probably damaging Het
Atp11b A G 3: 35,855,122 D1155G probably damaging Het
Atp2c1 T A 9: 105,432,726 T551S probably benign Het
Atp7b A T 8: 22,027,980 C281S probably damaging Het
Bmp1 C T 14: 70,492,466 C466Y probably damaging Het
Cabin1 T C 10: 75,734,976 probably null Het
Capn9 T G 8: 124,591,685 C97G probably damaging Het
Cbfa2t3 A G 8: 122,643,293 V147A probably damaging Het
Ccdc83 T A 7: 90,244,141 Y136F probably damaging Het
Cdh6 C A 15: 13,051,476 R357L possibly damaging Het
Celf1 A T 2: 91,010,408 N367I probably damaging Het
Cep350 T C 1: 155,914,721 I1363V probably benign Het
Colec12 T A 18: 9,874,813 D696E probably benign Het
Ctbp1 C T 5: 33,250,986 E138K probably damaging Het
Cyp4a10 T C 4: 115,525,392 I293T probably damaging Het
D430042O09Rik C G 7: 125,860,566 H1189D probably damaging Het
Dclk2 G A 3: 86,920,035 P46S probably damaging Het
Dctn1 C T 6: 83,189,956 T263I probably damaging Het
Ddx49 A T 8: 70,295,444 V317E probably damaging Het
Edil3 G A 13: 88,944,953 probably null Het
Egflam A T 15: 7,237,804 V700E possibly damaging Het
Fam168b A G 1: 34,819,865 probably null Het
Gigyf2 T G 1: 87,374,113 probably null Het
Gm5346 A T 8: 43,627,037 V50D probably benign Het
Heatr4 A G 12: 83,979,740 S248P probably benign Het
Hist1h1c C G 13: 23,739,409 S187R probably benign Het
Hoxd1 A T 2: 74,764,180 I260F possibly damaging Het
Hsd3b3 A T 3: 98,742,092 L305Q probably damaging Het
Itch T A 2: 155,210,459 C660S possibly damaging Het
Ivd A T 2: 118,871,500 I138F probably benign Het
Lcn4 G T 2: 26,671,216 Q18K possibly damaging Het
Mapkbp1 T C 2: 120,012,665 Y192H probably damaging Het
Mn1 T C 5: 111,418,857 L231P probably damaging Het
Morc1 A G 16: 48,565,646 D544G probably benign Het
Mthfd1 C A 12: 76,297,519 T331K probably damaging Het
Myo18b T A 5: 112,873,557 Y546F probably benign Het
Nod1 T C 6: 54,939,325 Y129C probably damaging Het
Nprl3 A G 11: 32,232,973 V563A probably damaging Het
Olfr1253 A T 2: 89,752,073 C252S possibly damaging Het
Olfr46 T C 7: 140,610,585 Y140H probably damaging Het
Olfr497 T C 7: 108,423,182 F204L probably benign Het
Olfr904 T C 9: 38,464,241 S67P probably damaging Het
Olfr998 A G 2: 85,591,422 N294S probably damaging Het
Orc3 T A 4: 34,611,049 probably null Het
Otog T C 7: 46,264,074 V777A probably benign Het
Pbxip1 G T 3: 89,448,713 V711L probably benign Het
Pcdhb16 A G 18: 37,478,263 D92G probably damaging Het
Phkb T A 8: 86,056,467 M964K probably damaging Het
Pitpnm2 T A 5: 124,152,621 M1L probably damaging Het
Pkhd1 A G 1: 20,199,459 V3287A probably damaging Het
Ppp4r4 T C 12: 103,585,757 S195P probably damaging Het
Prdm2 T C 4: 143,134,947 Y591C probably damaging Het
Rgsl1 T A 1: 153,825,905 T268S possibly damaging Het
Scd2 A T 19: 44,303,171 T350S probably benign Het
Scn7a T A 2: 66,687,747 Q1040L possibly damaging Het
Sdhb T A 4: 140,979,029 L259Q probably damaging Het
Senp6 A G 9: 80,126,398 H701R probably damaging Het
Slc41a2 C T 10: 83,304,303 probably null Het
Slx4 T C 16: 3,979,921 D1533G probably damaging Het
Spef2 T C 15: 9,713,185 K367R possibly damaging Het
Sstr3 G A 15: 78,540,511 T12M probably benign Het
Synj2 G T 17: 5,996,946 E20D probably damaging Het
Tchh G T 3: 93,445,974 R907L unknown Het
Thsd1 A G 8: 22,259,231 E645G probably benign Het
Tmem176b A T 6: 48,835,449 M194K probably damaging Het
Tmprss11f T C 5: 86,591,406 probably null Het
Trim44 G A 2: 102,400,377 probably benign Het
Triml1 T A 8: 43,130,605 R320W probably damaging Het
Trmt6 A T 2: 132,806,909 C401* probably null Het
Trpv5 T C 6: 41,659,728 probably null Het
V1rd19 T A 7: 24,003,301 L64* probably null Het
Vmn1r216 A T 13: 23,099,491 R115W probably damaging Het
Vmn2r58 T C 7: 41,860,500 N551S probably damaging Het
Vmn2r77 T C 7: 86,801,713 V269A probably benign Het
Vps13d A T 4: 145,155,243 V1254D probably benign Het
Xpr1 T C 1: 155,281,029 probably null Het
Zan T A 5: 137,452,450 T1622S unknown Het
Zfp112 T C 7: 24,126,751 Y715H probably damaging Het
Zfp750 G A 11: 121,513,125 P308L possibly damaging Het
Other mutations in Polq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Polq APN 16 37065247 splice site probably benign
IGL00539:Polq APN 16 37060569 missense probably damaging 0.98
IGL00960:Polq APN 16 37060512 missense probably damaging 0.96
IGL01100:Polq APN 16 37061112 missense probably benign
IGL01112:Polq APN 16 37017309 missense probably damaging 1.00
IGL01138:Polq APN 16 37045869 missense possibly damaging 0.94
IGL01432:Polq APN 16 37071822 splice site probably benign
IGL01522:Polq APN 16 37027903 missense probably damaging 1.00
IGL01565:Polq APN 16 37013113 missense probably benign 0.00
IGL01592:Polq APN 16 37034850 missense probably benign 0.01
IGL01690:Polq APN 16 37062838 missense probably damaging 0.97
IGL01943:Polq APN 16 37061443 missense possibly damaging 0.47
IGL02531:Polq APN 16 37062374 missense possibly damaging 0.75
IGL02553:Polq APN 16 37041768 missense probably damaging 1.00
IGL02623:Polq APN 16 37060375 missense probably benign 0.04
IGL02692:Polq APN 16 37060627 missense probably damaging 1.00
IGL02717:Polq APN 16 37022740 missense probably damaging 1.00
IGL02937:Polq APN 16 37013109 missense probably benign 0.14
IGL02959:Polq APN 16 37086566 missense probably damaging 1.00
IGL03086:Polq APN 16 37091049 missense probably benign 0.02
IGL03141:Polq APN 16 37017358 splice site probably benign
IGL03302:Polq APN 16 37071772 missense probably damaging 1.00
IGL03393:Polq APN 16 37044794 missense probably damaging 1.00
R0013_Polq_667 UTSW 16 37061839 missense possibly damaging 0.56
R4238_Polq_233 UTSW 16 37013181 missense probably damaging 1.00
R4280_polq_867 UTSW 16 37082057 missense probably damaging 1.00
G1Funyon:Polq UTSW 16 37061819 missense probably damaging 1.00
PIT4403001:Polq UTSW 16 37060587 missense probably benign 0.00
R0013:Polq UTSW 16 37061839 missense possibly damaging 0.56
R0082:Polq UTSW 16 37017257 missense probably benign 0.01
R0212:Polq UTSW 16 37066854 missense probably damaging 0.99
R0387:Polq UTSW 16 37029430 missense probably damaging 1.00
R0387:Polq UTSW 16 37089317 missense probably damaging 1.00
R0427:Polq UTSW 16 37061993 nonsense probably null
R0454:Polq UTSW 16 37034890 missense probably damaging 0.98
R0513:Polq UTSW 16 37094502 missense probably damaging 1.00
R0622:Polq UTSW 16 37060993 missense probably benign 0.02
R0848:Polq UTSW 16 37062130 missense probably benign 0.08
R1142:Polq UTSW 16 37013217 missense probably damaging 0.98
R1218:Polq UTSW 16 37029446 missense possibly damaging 0.93
R1331:Polq UTSW 16 37041747 missense probably damaging 1.00
R1398:Polq UTSW 16 37062495 missense possibly damaging 0.87
R1424:Polq UTSW 16 37086528 missense probably damaging 1.00
R1644:Polq UTSW 16 37060264 missense probably damaging 0.96
R1777:Polq UTSW 16 37060224 missense possibly damaging 0.94
R1820:Polq UTSW 16 37029418 missense possibly damaging 0.48
R1854:Polq UTSW 16 37062109 missense probably benign 0.01
R1880:Polq UTSW 16 37086592 missense possibly damaging 0.90
R1932:Polq UTSW 16 37062304 missense possibly damaging 0.92
R2014:Polq UTSW 16 37078366 missense probably damaging 1.00
R2026:Polq UTSW 16 37062745 missense possibly damaging 0.93
R2178:Polq UTSW 16 37062829 missense probably damaging 1.00
R2259:Polq UTSW 16 37062097 missense probably benign 0.03
R2266:Polq UTSW 16 37062153 missense possibly damaging 0.59
R2305:Polq UTSW 16 37062337 missense probably damaging 0.99
R2370:Polq UTSW 16 37073939 missense probably damaging 1.00
R2504:Polq UTSW 16 37011942 missense unknown
R2517:Polq UTSW 16 37089325 missense probably damaging 1.00
R2697:Polq UTSW 16 37042153 missense probably damaging 1.00
R2858:Polq UTSW 16 37062753 missense possibly damaging 0.88
R3436:Polq UTSW 16 37062337 missense probably damaging 0.99
R3437:Polq UTSW 16 37062337 missense probably damaging 0.99
R3699:Polq UTSW 16 37042156 missense probably damaging 1.00
R3838:Polq UTSW 16 37078349 missense probably damaging 1.00
R3875:Polq UTSW 16 37074027 missense probably damaging 0.99
R4050:Polq UTSW 16 37092820 critical splice acceptor site probably null
R4172:Polq UTSW 16 37060758 missense probably benign 0.02
R4238:Polq UTSW 16 37013181 missense probably damaging 1.00
R4240:Polq UTSW 16 37013181 missense probably damaging 1.00
R4280:Polq UTSW 16 37082057 missense probably damaging 1.00
R4296:Polq UTSW 16 37061301 missense possibly damaging 0.94
R4360:Polq UTSW 16 37060339 missense probably benign 0.00
R4373:Polq UTSW 16 37013181 missense probably damaging 1.00
R4375:Polq UTSW 16 37013181 missense probably damaging 1.00
R4376:Polq UTSW 16 37013181 missense probably damaging 1.00
R4509:Polq UTSW 16 37048563 missense probably damaging 1.00
R4510:Polq UTSW 16 37048563 missense probably damaging 1.00
R4511:Polq UTSW 16 37048563 missense probably damaging 1.00
R4543:Polq UTSW 16 37060785 missense probably benign 0.43
R4633:Polq UTSW 16 37048542 missense probably damaging 1.00
R4739:Polq UTSW 16 37041747 missense probably damaging 1.00
R4834:Polq UTSW 16 37027814 missense probably damaging 1.00
R4841:Polq UTSW 16 37048783 critical splice donor site probably null
R4842:Polq UTSW 16 37048783 critical splice donor site probably null
R4937:Polq UTSW 16 37027912 missense probably benign 0.01
R4955:Polq UTSW 16 37061082 missense probably benign 0.32
R4992:Polq UTSW 16 37061162 missense possibly damaging 0.59
R5008:Polq UTSW 16 37062387 missense probably benign
R5221:Polq UTSW 16 37042178 missense probably damaging 0.98
R5254:Polq UTSW 16 37089319 missense probably damaging 1.00
R5292:Polq UTSW 16 37061383 missense probably damaging 1.00
R5375:Polq UTSW 16 37082784 missense probably damaging 1.00
R5480:Polq UTSW 16 37013290 splice site probably benign
R5552:Polq UTSW 16 37094510 missense possibly damaging 0.93
R5591:Polq UTSW 16 37011885 utr 5 prime probably benign
R5653:Polq UTSW 16 37040534 missense probably damaging 1.00
R5708:Polq UTSW 16 37061018 missense probably damaging 0.98
R5754:Polq UTSW 16 37017263 missense probably benign
R5757:Polq UTSW 16 37086681 missense probably benign 0.01
R5764:Polq UTSW 16 37017344 missense probably damaging 0.97
R6019:Polq UTSW 16 37061764 missense probably damaging 1.00
R6170:Polq UTSW 16 37045812 missense possibly damaging 0.82
R6177:Polq UTSW 16 37071709 missense probably damaging 0.98
R6307:Polq UTSW 16 37017356 critical splice donor site probably null
R6499:Polq UTSW 16 37060827 missense probably benign 0.03
R6520:Polq UTSW 16 37060377 missense possibly damaging 0.88
R6598:Polq UTSW 16 37061631 missense probably benign 0.39
R6694:Polq UTSW 16 37015173 missense probably null 0.99
R6788:Polq UTSW 16 37077148 missense probably damaging 1.00
R7104:Polq UTSW 16 37089353 nonsense probably null
R7159:Polq UTSW 16 37062853 missense possibly damaging 0.87
R7222:Polq UTSW 16 37086633 nonsense probably null
R7340:Polq UTSW 16 37060926 missense probably benign 0.00
R7361:Polq UTSW 16 37060428 missense probably benign 0.00
R7384:Polq UTSW 16 37029418 missense probably damaging 1.00
R7509:Polq UTSW 16 37060343 missense probably benign
R7509:Polq UTSW 16 37060344 missense probably benign 0.00
R7575:Polq UTSW 16 37091134 missense probably benign 0.00
R7785:Polq UTSW 16 37027877 missense probably damaging 1.00
R7787:Polq UTSW 16 37017309 missense probably damaging 1.00
R7891:Polq UTSW 16 37027882 missense probably damaging 1.00
R7898:Polq UTSW 16 37044883 missense probably damaging 0.98
R7917:Polq UTSW 16 37065288 missense probably benign 0.08
R7940:Polq UTSW 16 37060642 missense probably benign 0.27
R8028:Polq UTSW 16 37061316 missense possibly damaging 0.82
R8114:Polq UTSW 16 37042215 missense possibly damaging 0.94
R8144:Polq UTSW 16 37029484 missense probably benign 0.01
R8288:Polq UTSW 16 37027910 missense probably damaging 1.00
R8301:Polq UTSW 16 37061819 missense probably damaging 1.00
R8341:Polq UTSW 16 37071771 missense possibly damaging 0.96
R8348:Polq UTSW 16 37017197 critical splice acceptor site probably null
R8448:Polq UTSW 16 37017197 critical splice acceptor site probably null
R8815:Polq UTSW 16 37033531 missense probably damaging 1.00
R8843:Polq UTSW 16 37011918 missense unknown
R8878:Polq UTSW 16 37040507 missense probably benign 0.02
X0060:Polq UTSW 16 37017237 nonsense probably null
Z1176:Polq UTSW 16 37042257 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTTAAGTCCAGAACTGCAAAGG -3'
(R):5'- AACAACTTTCCCCTGGCTG -3'

Sequencing Primer
(F):5'- GTCCAGAACTGCAAAGGATTTTAG -3'
(R):5'- GTAAAGCACTGCTGGCTTTCTGAC -3'
Posted On2014-08-25