Incidental Mutation 'R1968:Samsn1'
ID219321
Institutional Source Beutler Lab
Gene Symbol Samsn1
Ensembl Gene ENSMUSG00000022876
Gene NameSAM domain, SH3 domain and nuclear localization signals, 1
Synonyms4930571B16Rik, Hacs1
MMRRC Submission 039981-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1968 (G1)
Quality Score195
Status Not validated
Chromosome16
Chromosomal Location75858793-76022281 bp(-) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) C to T at 75945573 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000114240]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114240
SMART Domains Protein: ENSMUSP00000109878
Gene: ENSMUSG00000022876

DomainStartEndE-ValueType
low complexity region 69 80 N/A INTRINSIC
Pfam:SLY 146 293 1.1e-55 PFAM
SH3 295 352 8.78e-4 SMART
SAM 367 434 7.6e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226794
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227215
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SAMSN1 is a member of a novel gene family of putative adaptors and scaffold proteins containing SH3 and SAM (sterile alpha motif) domains (Claudio et al., 2001 [PubMed 11536050]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced adaptive immunity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,322,199 L528Q probably damaging Het
Adam18 T A 8: 24,646,447 T353S probably benign Het
Aldh1a3 A G 7: 66,411,500 probably null Het
Aldh3b2 T A 19: 3,980,705 M390K probably benign Het
Arhgap45 T C 10: 80,027,702 I793T probably damaging Het
Arsb A G 13: 93,807,559 M253V probably benign Het
Atcay T C 10: 81,212,478 D258G possibly damaging Het
Atf1 G T 15: 100,254,514 probably null Het
Atp1a4 C T 1: 172,240,164 E511K probably benign Het
Atp8a1 A G 5: 67,667,657 V777A probably benign Het
Baz1a T C 12: 54,900,337 T1173A possibly damaging Het
Bdh2 A T 3: 135,285,609 D15V probably benign Het
Cacna1e T C 1: 154,700,494 Y69C probably damaging Het
Caskin2 A G 11: 115,803,614 L387P probably benign Het
Cat T C 2: 103,484,989 E17G probably benign Het
Ccdc15 T C 9: 37,347,795 I54M probably benign Het
Cdhr1 T G 14: 37,079,725 I754L probably benign Het
Cep120 G A 18: 53,723,241 T368I probably benign Het
Cep126 C A 9: 8,100,908 D542Y probably damaging Het
Cep135 T C 5: 76,624,747 S660P possibly damaging Het
Cfap70 A T 14: 20,420,811 S455R possibly damaging Het
Chd8 A G 14: 52,220,993 M886T probably damaging Het
Ckap5 T C 2: 91,586,343 S1098P probably benign Het
Clec4e A T 6: 123,283,574 I204N probably damaging Het
Cntnap5c G A 17: 58,359,296 R1107H probably damaging Het
Cramp1l T C 17: 24,964,939 D1234G probably damaging Het
Csf1r A T 18: 61,112,795 I275L probably benign Het
Cyp27a1 A G 1: 74,737,276 E457G probably benign Het
Cyp2d11 T C 15: 82,389,548 T410A probably benign Het
Cyp2d22 G C 15: 82,373,172 T264S probably benign Het
Cyr61 T C 3: 145,648,210 Y275C probably damaging Het
Daam2 G A 17: 49,483,060 R390W probably damaging Het
Decr2 T C 17: 26,083,079 S226G probably benign Het
Dennd6b T C 15: 89,190,341 D91G possibly damaging Het
Dglucy T C 12: 100,859,644 V515A possibly damaging Het
Dlg5 A T 14: 24,164,119 L734* probably null Het
Dopey2 A G 16: 93,782,419 N1690D probably damaging Het
Exoc5 A G 14: 49,034,890 Y356H probably benign Het
Fut7 T A 2: 25,425,726 V332D probably benign Het
Gm436 A G 4: 144,670,623 Y180H possibly damaging Het
Gnas T C 2: 174,298,733 S232P probably damaging Het
Gramd4 A G 15: 86,132,905 E522G probably damaging Het
Gys1 A G 7: 45,443,546 T297A probably damaging Het
Herc4 T C 10: 63,273,525 S180P probably benign Het
Hivep3 C T 4: 120,096,238 P584S possibly damaging Het
Itpk1 G T 12: 102,675,470 probably null Het
Jmjd1c A T 10: 67,225,440 S1191C probably damaging Het
Lima1 T C 15: 99,819,684 N147S probably benign Het
Lrmp T A 6: 145,169,773 S310T probably damaging Het
Map4k5 G A 12: 69,818,492 T506I probably damaging Het
Mat1a A T 14: 41,111,034 E58V probably damaging Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Mon2 A G 10: 123,009,565 Y1413H probably damaging Het
Mpp3 C A 11: 102,018,552 probably benign Het
Mpp4 T A 1: 59,144,802 I260F probably damaging Het
Myocd C A 11: 65,200,907 G70C probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nckap5 T A 1: 126,014,630 D209V probably damaging Het
Nlrp9a A G 7: 26,564,941 K707R probably benign Het
Npr3 A G 15: 11,904,969 L224S probably benign Het
Olfr1036 T A 2: 86,075,205 L155Q probably damaging Het
Olfr1153 T A 2: 87,897,039 V280E probably damaging Het
Olfr821 A G 10: 130,033,733 S36G probably damaging Het
Otof C T 5: 30,388,654 D467N probably damaging Het
Paxx T C 2: 25,460,628 probably benign Het
Pcmt1 G A 10: 7,640,710 R179* probably null Het
Phkb T A 8: 85,970,951 V463D probably benign Het
Prkcq T C 2: 11,245,397 V175A probably damaging Het
Rasl11b T G 5: 74,196,136 I58S probably damaging Het
Rb1cc1 A T 1: 6,248,195 probably null Het
Reck T A 4: 43,913,771 probably null Het
Riox1 G T 12: 83,951,382 D231Y probably damaging Het
Rlf T A 4: 121,148,420 N1231I probably damaging Het
Rpn1 A G 6: 88,095,548 D291G possibly damaging Het
Scara5 T C 14: 65,689,800 C49R possibly damaging Het
Serpini1 A G 3: 75,614,478 D92G probably benign Het
Setdb2 A T 14: 59,419,409 L153Q probably damaging Het
Sh3rf3 C T 10: 58,813,987 T138M probably benign Het
Shkbp1 C T 7: 27,355,400 probably null Het
Slc22a29 G A 19: 8,218,343 P111S probably benign Het
Smarca1 A G X: 47,852,687 V618A probably damaging Het
Spef2 T A 15: 9,609,516 M1308L probably damaging Het
Spink5 A G 18: 43,990,708 N354S probably benign Het
Srrm2 T C 17: 23,821,491 S2370P probably damaging Het
Ssxb3 A T X: 8,588,666 I28N probably damaging Het
Sucla2 A G 14: 73,593,679 T411A probably damaging Het
Tex38 A C 4: 115,780,340 S89A probably benign Het
Tjp2 A T 19: 24,111,073 D723E probably damaging Het
Tln2 A T 9: 67,255,901 N1121K probably damaging Het
Tti1 T C 2: 158,009,046 E91G possibly damaging Het
Wbp2 A T 11: 116,082,365 M72K possibly damaging Het
Wdfy4 C A 14: 33,106,044 C1062F possibly damaging Het
Wiz A G 17: 32,359,372 Y389H probably damaging Het
Zcchc3 T C 2: 152,414,092 K229R probably damaging Het
Zmat3 C A 3: 32,360,982 D60Y probably damaging Het
Other mutations in Samsn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Samsn1 APN 16 75909120 splice site probably benign
IGL02220:Samsn1 APN 16 75883875 critical splice donor site probably null
R0455:Samsn1 UTSW 16 75945225 unclassified noncoding transcript
R1136:Samsn1 UTSW 16 75873520 missense probably null 0.00
R1140:Samsn1 UTSW 16 75888742 missense possibly damaging 0.73
R1180:Samsn1 UTSW 16 75873648 missense probably damaging 1.00
R1772:Samsn1 UTSW 16 75870775 missense probably benign 0.01
R4035:Samsn1 UTSW 16 75909185 start codon destroyed probably null 0.99
R4372:Samsn1 UTSW 16 75859456 missense possibly damaging 0.80
R4725:Samsn1 UTSW 16 75945329 unclassified noncoding transcript
R4779:Samsn1 UTSW 16 75947289 exon noncoding transcript
R4795:Samsn1 UTSW 16 75883845 intron probably benign
R4899:Samsn1 UTSW 16 75879103 missense probably damaging 1.00
R4905:Samsn1 UTSW 16 75876465 missense possibly damaging 0.94
R5050:Samsn1 UTSW 16 75888757 missense probably benign
R5789:Samsn1 UTSW 16 75876448 missense probably damaging 1.00
R6005:Samsn1 UTSW 16 75873514 missense probably benign 0.03
R6190:Samsn1 UTSW 16 75870915 missense probably damaging 1.00
R6218:Samsn1 UTSW 16 75945274 unclassified noncoding transcript
R6630:Samsn1 UTSW 16 75879204 missense probably benign 0.00
R7086:Samsn1 UTSW 16 75870906 missense probably benign 0.00
R8289:Samsn1 UTSW 16 75888796 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAACGGTTTCAAGTTCCCC -3'
(R):5'- TGCTTTGTGAAACTGACTGACTTC -3'

Sequencing Primer
(F):5'- CACTGGAACTTCAATCTCATAAGGAG -3'
(R):5'- GTGAAACTGACTGACTTCCTGGC -3'
Posted On2014-08-25