Incidental Mutation 'R2009:Olfr248'
ID219324
Institutional Source Beutler Lab
Gene Symbol Olfr248
Ensembl Gene ENSMUSG00000059503
Gene Nameolfactory receptor 248
SynonymsGA_x6K02T2P20D-20771141-20770212, GA_x6K02T2MFC0-1145-1312, MOR267-7, Olfr415
MMRRC Submission 040018-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R2009 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location174391046-174392055 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 174391429 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 120 (R120L)
Ref Sequence ENSEMBL: ENSMUSP00000074799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075329]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075329
AA Change: R120L

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074799
Gene: ENSMUSG00000059503
AA Change: R120L

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.2e-40 PFAM
Pfam:7tm_1 39 303 7.5e-22 PFAM
Meta Mutation Damage Score 0.2346 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 T A 9: 30,922,137 D34V probably benign Het
Adgrf1 A T 17: 43,321,221 R884* probably null Het
Adgrg7 T C 16: 56,761,873 T301A probably benign Het
Als2cr11b A T 1: 59,003,232 noncoding transcript Het
Arhgef17 A G 7: 100,881,781 I1366T probably damaging Het
BC037034 C A 5: 138,260,929 C434F probably damaging Het
C1s2 A T 6: 124,635,089 L112H probably damaging Het
Cfap74 G A 4: 155,420,267 R103H possibly damaging Het
Col7a1 A T 9: 108,968,875 probably null Het
Dmp1 A G 5: 104,212,840 S461G probably damaging Het
Eif4g2 A T 7: 111,074,198 D753E probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etv4 T C 11: 101,774,237 D130G probably damaging Het
Gabbr2 A T 4: 46,734,119 I533N probably damaging Het
Gne T C 4: 44,055,273 E234G probably benign Het
Itga6 C A 2: 71,816,681 N78K probably benign Het
Lap3 C T 5: 45,493,557 T33M probably benign Het
Limd1 A G 9: 123,479,499 S88G probably benign Het
Lrp1 G T 10: 127,544,516 T3922K probably damaging Het
Map4k3 A G 17: 80,664,088 probably benign Het
Mib1 T C 18: 10,812,118 L263S probably damaging Het
Ncor1 T C 11: 62,325,601 S1474G probably benign Het
Nkapl A C 13: 21,467,437 S335R probably damaging Het
Nrg3 A G 14: 38,370,814 S605P probably damaging Het
Olfr549 A G 7: 102,554,944 Y220C probably damaging Het
Patj G A 4: 98,456,169 D577N probably damaging Het
Pfpl A C 19: 12,429,955 K523N possibly damaging Het
Pik3c2a A C 7: 116,364,503 L924R probably damaging Het
Pkd2l1 C A 19: 44,155,964 R278L probably benign Het
Prss2 A T 6: 41,523,976 I108F probably damaging Het
Rnase2b A G 14: 51,162,890 T143A possibly damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Sphk2 A T 7: 45,711,013 H522Q probably damaging Het
Szt2 A G 4: 118,378,064 probably null Het
Tmem88 C A 11: 69,397,776 A106S probably damaging Het
Trim39 A G 17: 36,263,754 L252S possibly damaging Het
Trim60 T A 8: 65,001,323 E91D probably damaging Het
Trpm5 A G 7: 143,087,738 I145T possibly damaging Het
Vmn2r107 A T 17: 20,375,467 M761L probably benign Het
Wdr4 G A 17: 31,500,610 probably benign Het
Wfs1 A T 5: 36,968,309 S413T probably damaging Het
Wnt2 A T 6: 18,030,209 W27R probably damaging Het
Zc3h3 A T 15: 75,779,309 H687Q probably damaging Het
Zfp750 G A 11: 121,513,125 P308L possibly damaging Het
Other mutations in Olfr248
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01649:Olfr248 APN 1 174391408 missense probably damaging 1.00
R0375:Olfr248 UTSW 1 174391209 missense probably damaging 1.00
R1720:Olfr248 UTSW 1 174391920 missense probably benign 0.00
R1906:Olfr248 UTSW 1 174391164 missense probably damaging 1.00
R1996:Olfr248 UTSW 1 174391417 missense probably damaging 1.00
R4745:Olfr248 UTSW 1 174391876 missense probably damaging 1.00
R5294:Olfr248 UTSW 1 174391225 missense probably benign
R5297:Olfr248 UTSW 1 174391200 missense probably benign 0.21
R5665:Olfr248 UTSW 1 174391375 missense probably damaging 1.00
R5784:Olfr248 UTSW 1 174391399 missense probably damaging 1.00
R5857:Olfr248 UTSW 1 174391108 missense possibly damaging 0.59
R6943:Olfr248 UTSW 1 174391841 nonsense probably null
R6975:Olfr248 UTSW 1 174391677 missense probably benign 0.10
R7114:Olfr248 UTSW 1 174391239 missense probably damaging 0.96
R7614:Olfr248 UTSW 1 174391654 missense probably damaging 0.99
R8036:Olfr248 UTSW 1 174391816 missense probably damaging 1.00
R8674:Olfr248 UTSW 1 174391692 missense probably damaging 1.00
R8777:Olfr248 UTSW 1 174391282 missense probably damaging 1.00
R8777-TAIL:Olfr248 UTSW 1 174391282 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGGCAGACAGATATCTCCAC -3'
(R):5'- CTCAGAACTGCCCTCATATGG -3'

Sequencing Primer
(F):5'- GACAGATATCTCCACACTCCTATG -3'
(R):5'- CCCTCATATGGCAGAAGAAGTGTC -3'
Posted On2014-08-25