Incidental Mutation 'R1968:Abcc10'
ID219333
Institutional Source Beutler Lab
Gene Symbol Abcc10
Ensembl Gene ENSMUSG00000032842
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 10
SynonymsMrp7
MMRRC Submission 039981-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R1968 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location46303221-46328352 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46322199 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 528 (L528Q)
Ref Sequence ENSEMBL: ENSMUSP00000092895 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047970] [ENSMUST00000095261] [ENSMUST00000167360] [ENSMUST00000168490] [ENSMUST00000171584]
Predicted Effect probably damaging
Transcript: ENSMUST00000047970
AA Change: L569Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038041
Gene: ENSMUSG00000032842
AA Change: L569Q

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 552 5.4e-24 PFAM
AAA 626 809 5.76e-8 SMART
low complexity region 841 852 N/A INTRINSIC
Pfam:ABC_membrane 889 1203 1.7e-33 PFAM
low complexity region 1231 1245 N/A INTRINSIC
AAA 1281 1490 3.57e-13 SMART
low complexity region 1506 1517 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000095261
AA Change: L528Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000092895
Gene: ENSMUSG00000032842
AA Change: L528Q

DomainStartEndE-ValueType
transmembrane domain 29 48 N/A INTRINSIC
transmembrane domain 58 80 N/A INTRINSIC
transmembrane domain 93 112 N/A INTRINSIC
transmembrane domain 127 149 N/A INTRINSIC
Pfam:ABC_membrane 245 511 2.1e-30 PFAM
AAA 585 768 5.76e-8 SMART
low complexity region 800 811 N/A INTRINSIC
transmembrane domain 836 858 N/A INTRINSIC
Pfam:ABC_membrane 896 1162 6.9e-26 PFAM
low complexity region 1190 1204 N/A INTRINSIC
AAA 1240 1424 1.67e-13 SMART
low complexity region 1440 1451 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165733
Predicted Effect probably damaging
Transcript: ENSMUST00000167360
AA Change: L569Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131843
Gene: ENSMUSG00000032842
AA Change: L569Q

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 552 2.2e-30 PFAM
AAA 626 809 5.76e-8 SMART
low complexity region 841 852 N/A INTRINSIC
transmembrane domain 877 899 N/A INTRINSIC
Pfam:ABC_membrane 937 1203 7.2e-26 PFAM
low complexity region 1231 1245 N/A INTRINSIC
AAA 1281 1465 1.67e-13 SMART
low complexity region 1481 1492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168490
SMART Domains Protein: ENSMUSP00000132760
Gene: ENSMUSG00000032842

DomainStartEndE-ValueType
AAA 75 242 4.61e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170168
Predicted Effect probably benign
Transcript: ENSMUST00000171584
SMART Domains Protein: ENSMUSP00000132561
Gene: ENSMUSG00000032842

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
transmembrane domain 70 89 N/A INTRINSIC
transmembrane domain 99 121 N/A INTRINSIC
transmembrane domain 134 153 N/A INTRINSIC
transmembrane domain 168 190 N/A INTRINSIC
Pfam:ABC_membrane 286 462 8.3e-18 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This ABC transporter is a member of the MRP subfamily which is involved in multi-drug resistance. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homzozygous for a knock-out allele exhibit increased sensitivity to paclitaxel-induced mortality associated with weight loss, decreased white blood cell, and small spleen and thymus cortex due to apoptosis and/or depopulation of lymphoid cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 T A 8: 24,646,447 T353S probably benign Het
Aldh1a3 A G 7: 66,411,500 probably null Het
Aldh3b2 T A 19: 3,980,705 M390K probably benign Het
Arhgap45 T C 10: 80,027,702 I793T probably damaging Het
Arsb A G 13: 93,807,559 M253V probably benign Het
Atcay T C 10: 81,212,478 D258G possibly damaging Het
Atf1 G T 15: 100,254,514 probably null Het
Atp1a4 C T 1: 172,240,164 E511K probably benign Het
Atp8a1 A G 5: 67,667,657 V777A probably benign Het
Baz1a T C 12: 54,900,337 T1173A possibly damaging Het
Bdh2 A T 3: 135,285,609 D15V probably benign Het
Cacna1e T C 1: 154,700,494 Y69C probably damaging Het
Caskin2 A G 11: 115,803,614 L387P probably benign Het
Cat T C 2: 103,484,989 E17G probably benign Het
Ccdc15 T C 9: 37,347,795 I54M probably benign Het
Cdhr1 T G 14: 37,079,725 I754L probably benign Het
Cep120 G A 18: 53,723,241 T368I probably benign Het
Cep126 C A 9: 8,100,908 D542Y probably damaging Het
Cep135 T C 5: 76,624,747 S660P possibly damaging Het
Cfap70 A T 14: 20,420,811 S455R possibly damaging Het
Chd8 A G 14: 52,220,993 M886T probably damaging Het
Ckap5 T C 2: 91,586,343 S1098P probably benign Het
Clec4e A T 6: 123,283,574 I204N probably damaging Het
Cntnap5c G A 17: 58,359,296 R1107H probably damaging Het
Cramp1l T C 17: 24,964,939 D1234G probably damaging Het
Csf1r A T 18: 61,112,795 I275L probably benign Het
Cyp27a1 A G 1: 74,737,276 E457G probably benign Het
Cyp2d11 T C 15: 82,389,548 T410A probably benign Het
Cyp2d22 G C 15: 82,373,172 T264S probably benign Het
Cyr61 T C 3: 145,648,210 Y275C probably damaging Het
Daam2 G A 17: 49,483,060 R390W probably damaging Het
Decr2 T C 17: 26,083,079 S226G probably benign Het
Dennd6b T C 15: 89,190,341 D91G possibly damaging Het
Dglucy T C 12: 100,859,644 V515A possibly damaging Het
Dlg5 A T 14: 24,164,119 L734* probably null Het
Dopey2 A G 16: 93,782,419 N1690D probably damaging Het
Exoc5 A G 14: 49,034,890 Y356H probably benign Het
Fut7 T A 2: 25,425,726 V332D probably benign Het
Gm436 A G 4: 144,670,623 Y180H possibly damaging Het
Gnas T C 2: 174,298,733 S232P probably damaging Het
Gramd4 A G 15: 86,132,905 E522G probably damaging Het
Gys1 A G 7: 45,443,546 T297A probably damaging Het
Herc4 T C 10: 63,273,525 S180P probably benign Het
Hivep3 C T 4: 120,096,238 P584S possibly damaging Het
Itpk1 G T 12: 102,675,470 probably null Het
Jmjd1c A T 10: 67,225,440 S1191C probably damaging Het
Lima1 T C 15: 99,819,684 N147S probably benign Het
Lrmp T A 6: 145,169,773 S310T probably damaging Het
Map4k5 G A 12: 69,818,492 T506I probably damaging Het
Mat1a A T 14: 41,111,034 E58V probably damaging Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Mon2 A G 10: 123,009,565 Y1413H probably damaging Het
Mpp3 C A 11: 102,018,552 probably benign Het
Mpp4 T A 1: 59,144,802 I260F probably damaging Het
Myocd C A 11: 65,200,907 G70C probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nckap5 T A 1: 126,014,630 D209V probably damaging Het
Nlrp9a A G 7: 26,564,941 K707R probably benign Het
Npr3 A G 15: 11,904,969 L224S probably benign Het
Olfr1036 T A 2: 86,075,205 L155Q probably damaging Het
Olfr1153 T A 2: 87,897,039 V280E probably damaging Het
Olfr821 A G 10: 130,033,733 S36G probably damaging Het
Otof C T 5: 30,388,654 D467N probably damaging Het
Paxx T C 2: 25,460,628 probably benign Het
Pcmt1 G A 10: 7,640,710 R179* probably null Het
Phkb T A 8: 85,970,951 V463D probably benign Het
Prkcq T C 2: 11,245,397 V175A probably damaging Het
Rasl11b T G 5: 74,196,136 I58S probably damaging Het
Rb1cc1 A T 1: 6,248,195 probably null Het
Reck T A 4: 43,913,771 probably null Het
Riox1 G T 12: 83,951,382 D231Y probably damaging Het
Rlf T A 4: 121,148,420 N1231I probably damaging Het
Rpn1 A G 6: 88,095,548 D291G possibly damaging Het
Samsn1 C T 16: 75,945,573 noncoding transcript Het
Scara5 T C 14: 65,689,800 C49R possibly damaging Het
Serpini1 A G 3: 75,614,478 D92G probably benign Het
Setdb2 A T 14: 59,419,409 L153Q probably damaging Het
Sh3rf3 C T 10: 58,813,987 T138M probably benign Het
Shkbp1 C T 7: 27,355,400 probably null Het
Slc22a29 G A 19: 8,218,343 P111S probably benign Het
Smarca1 A G X: 47,852,687 V618A probably damaging Het
Spef2 T A 15: 9,609,516 M1308L probably damaging Het
Spink5 A G 18: 43,990,708 N354S probably benign Het
Srrm2 T C 17: 23,821,491 S2370P probably damaging Het
Ssxb3 A T X: 8,588,666 I28N probably damaging Het
Sucla2 A G 14: 73,593,679 T411A probably damaging Het
Tex38 A C 4: 115,780,340 S89A probably benign Het
Tjp2 A T 19: 24,111,073 D723E probably damaging Het
Tln2 A T 9: 67,255,901 N1121K probably damaging Het
Tti1 T C 2: 158,009,046 E91G possibly damaging Het
Wbp2 A T 11: 116,082,365 M72K possibly damaging Het
Wdfy4 C A 14: 33,106,044 C1062F possibly damaging Het
Wiz A G 17: 32,359,372 Y389H probably damaging Het
Zcchc3 T C 2: 152,414,092 K229R probably damaging Het
Zmat3 C A 3: 32,360,982 D60Y probably damaging Het
Other mutations in Abcc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00960:Abcc10 APN 17 46323745 missense probably damaging 1.00
IGL01115:Abcc10 APN 17 46310426 missense probably benign
IGL01380:Abcc10 APN 17 46324022 missense possibly damaging 0.90
IGL01476:Abcc10 APN 17 46327937 utr 5 prime probably benign
IGL01723:Abcc10 APN 17 46313745 missense probably damaging 1.00
IGL01867:Abcc10 APN 17 46324438 missense probably benign 0.07
IGL02065:Abcc10 APN 17 46312901 missense possibly damaging 0.60
IGL02233:Abcc10 APN 17 46324159 unclassified probably null
IGL03394:Abcc10 APN 17 46324351 missense probably damaging 1.00
Decrepit UTSW 17 46324391 missense probably damaging 1.00
shrivelled UTSW 17 46312419 missense probably benign
PIT4514001:Abcc10 UTSW 17 46305648 missense probably benign
R0366:Abcc10 UTSW 17 46324798 nonsense probably null
R0437:Abcc10 UTSW 17 46312919 splice site probably null
R0437:Abcc10 UTSW 17 46312920 splice site probably benign
R0549:Abcc10 UTSW 17 46322290 missense probably damaging 1.00
R0580:Abcc10 UTSW 17 46305956 splice site probably null
R1056:Abcc10 UTSW 17 46303954 missense possibly damaging 0.60
R1426:Abcc10 UTSW 17 46324435 missense probably damaging 0.97
R1595:Abcc10 UTSW 17 46322238 missense probably damaging 1.00
R1745:Abcc10 UTSW 17 46312433 missense probably benign
R1856:Abcc10 UTSW 17 46306603 missense probably damaging 1.00
R2070:Abcc10 UTSW 17 46303565 missense probably benign
R2071:Abcc10 UTSW 17 46303565 missense probably benign
R2255:Abcc10 UTSW 17 46305635 missense probably benign 0.18
R2425:Abcc10 UTSW 17 46310157 missense probably damaging 1.00
R4116:Abcc10 UTSW 17 46323891 missense possibly damaging 0.50
R4510:Abcc10 UTSW 17 46307210 missense probably damaging 0.98
R4511:Abcc10 UTSW 17 46307210 missense probably damaging 0.98
R4645:Abcc10 UTSW 17 46324774 missense probably damaging 1.00
R4689:Abcc10 UTSW 17 46324070 missense probably benign 0.00
R4778:Abcc10 UTSW 17 46304416 missense probably damaging 1.00
R5364:Abcc10 UTSW 17 46305651 missense probably benign 0.25
R5384:Abcc10 UTSW 17 46304435 missense possibly damaging 0.83
R5509:Abcc10 UTSW 17 46324259 missense probably benign 0.01
R5568:Abcc10 UTSW 17 46303908 splice site probably null
R5798:Abcc10 UTSW 17 46306003 nonsense probably null
R5906:Abcc10 UTSW 17 46316559 missense probably benign 0.02
R5908:Abcc10 UTSW 17 46313804 missense probably damaging 1.00
R5942:Abcc10 UTSW 17 46312407 missense probably benign 0.02
R5968:Abcc10 UTSW 17 46310151 missense probably benign
R6038:Abcc10 UTSW 17 46304360 missense probably damaging 1.00
R6038:Abcc10 UTSW 17 46304360 missense probably damaging 1.00
R6109:Abcc10 UTSW 17 46310377 missense probably benign 0.00
R6623:Abcc10 UTSW 17 46323462 missense probably damaging 1.00
R6851:Abcc10 UTSW 17 46312419 missense probably benign
R6927:Abcc10 UTSW 17 46324391 missense probably damaging 1.00
R7176:Abcc10 UTSW 17 46324277 missense probably benign 0.02
R7314:Abcc10 UTSW 17 46315404 missense probably damaging 0.98
R7463:Abcc10 UTSW 17 46323772 missense probably damaging 1.00
R7527:Abcc10 UTSW 17 46312904 missense possibly damaging 0.58
R7584:Abcc10 UTSW 17 46315378 splice site probably null
R7862:Abcc10 UTSW 17 46315532 nonsense probably null
R7883:Abcc10 UTSW 17 46307101 missense probably benign 0.03
R7896:Abcc10 UTSW 17 46324309 missense probably benign 0.08
R7897:Abcc10 UTSW 17 46324073 missense probably benign 0.00
R7945:Abcc10 UTSW 17 46315532 nonsense probably null
R7966:Abcc10 UTSW 17 46307101 missense probably benign 0.03
R7979:Abcc10 UTSW 17 46324309 missense probably benign 0.08
R7980:Abcc10 UTSW 17 46324073 missense probably benign 0.00
X0020:Abcc10 UTSW 17 46324120 missense probably damaging 0.98
Z1176:Abcc10 UTSW 17 46313700 missense probably damaging 0.97
Z1176:Abcc10 UTSW 17 46324262 missense probably benign 0.00
Z1177:Abcc10 UTSW 17 46307062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCATAGCGTCCAACAGGC -3'
(R):5'- CATTTCTAACCCAGGGCAGTC -3'

Sequencing Primer
(F):5'- CTTTAGTTCCAAGGGATCCAAGGC -3'
(R):5'- TAACCCAGGGCAGTCCAGTC -3'
Posted On2014-08-25