Incidental Mutation 'R2009:Szt2'
ID 219334
Institutional Source Beutler Lab
Gene Symbol Szt2
Ensembl Gene ENSMUSG00000033253
Gene Name SZT2 subunit of KICSTOR complex
Synonyms seaizure threshold 2
MMRRC Submission 040018-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.610) question?
Stock # R2009 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 118219940-118266470 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 118235261 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000074862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075406] [ENSMUST00000075406]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000075406
SMART Domains Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Blast:VWA 93 343 1e-109 BLAST
low complexity region 704 728 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1619 1630 N/A INTRINSIC
low complexity region 1662 1678 N/A INTRINSIC
low complexity region 1832 1854 N/A INTRINSIC
low complexity region 1862 1881 N/A INTRINSIC
low complexity region 1895 1914 N/A INTRINSIC
low complexity region 2176 2184 N/A INTRINSIC
low complexity region 2284 2292 N/A INTRINSIC
low complexity region 2309 2323 N/A INTRINSIC
low complexity region 2373 2384 N/A INTRINSIC
low complexity region 2500 2508 N/A INTRINSIC
low complexity region 2669 2680 N/A INTRINSIC
low complexity region 2739 2758 N/A INTRINSIC
low complexity region 3239 3252 N/A INTRINSIC
low complexity region 3257 3268 N/A INTRINSIC
low complexity region 3283 3309 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000075406
SMART Domains Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Blast:VWA 93 343 1e-109 BLAST
low complexity region 704 728 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1619 1630 N/A INTRINSIC
low complexity region 1662 1678 N/A INTRINSIC
low complexity region 1832 1854 N/A INTRINSIC
low complexity region 1862 1881 N/A INTRINSIC
low complexity region 1895 1914 N/A INTRINSIC
low complexity region 2176 2184 N/A INTRINSIC
low complexity region 2284 2292 N/A INTRINSIC
low complexity region 2309 2323 N/A INTRINSIC
low complexity region 2373 2384 N/A INTRINSIC
low complexity region 2500 2508 N/A INTRINSIC
low complexity region 2669 2680 N/A INTRINSIC
low complexity region 2739 2758 N/A INTRINSIC
low complexity region 3239 3252 N/A INTRINSIC
low complexity region 3257 3268 N/A INTRINSIC
low complexity region 3283 3309 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138386
Predicted Effect probably benign
Transcript: ENSMUST00000183402
Meta Mutation Damage Score 0.9489 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 T A 9: 30,833,433 (GRCm39) D34V probably benign Het
Adgrf1 A T 17: 43,632,112 (GRCm39) R884* probably null Het
Adgrg7 T C 16: 56,582,236 (GRCm39) T301A probably benign Het
Arhgef17 A G 7: 100,530,988 (GRCm39) I1366T probably damaging Het
C1s2 A T 6: 124,612,048 (GRCm39) L112H probably damaging Het
C2cd6 A T 1: 59,042,391 (GRCm39) noncoding transcript Het
Cfap74 G A 4: 155,504,724 (GRCm39) R103H possibly damaging Het
Col7a1 A T 9: 108,797,943 (GRCm39) probably null Het
Dmp1 A G 5: 104,360,706 (GRCm39) S461G probably damaging Het
Eif4g2 A T 7: 110,673,405 (GRCm39) D753E probably benign Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Etv4 T C 11: 101,665,063 (GRCm39) D130G probably damaging Het
Gabbr2 A T 4: 46,734,119 (GRCm39) I533N probably damaging Het
Gne T C 4: 44,055,273 (GRCm39) E234G probably benign Het
Itga6 C A 2: 71,647,025 (GRCm39) N78K probably benign Het
Lap3 C T 5: 45,650,899 (GRCm39) T33M probably benign Het
Limd1 A G 9: 123,308,564 (GRCm39) S88G probably benign Het
Lrp1 G T 10: 127,380,385 (GRCm39) T3922K probably damaging Het
Map4k3 A G 17: 80,971,517 (GRCm39) probably benign Het
Mib1 T C 18: 10,812,118 (GRCm39) L263S probably damaging Het
Ncor1 T C 11: 62,216,427 (GRCm39) S1474G probably benign Het
Nkapl A C 13: 21,651,607 (GRCm39) S335R probably damaging Het
Nrg3 A G 14: 38,092,771 (GRCm39) S605P probably damaging Het
Or10x4 G T 1: 174,218,995 (GRCm39) R120L possibly damaging Het
Or52b3 A G 7: 102,204,151 (GRCm39) Y220C probably damaging Het
Patj G A 4: 98,344,406 (GRCm39) D577N probably damaging Het
Pfpl A C 19: 12,407,319 (GRCm39) K523N possibly damaging Het
Pik3c2a A C 7: 115,963,738 (GRCm39) L924R probably damaging Het
Pkd2l1 C A 19: 44,144,403 (GRCm39) R278L probably benign Het
Prss2 A T 6: 41,500,910 (GRCm39) I108F probably damaging Het
Rnase2b A G 14: 51,400,347 (GRCm39) T143A possibly damaging Het
Sgk1 C T 10: 21,872,500 (GRCm39) R171W probably damaging Het
Sphk2 A T 7: 45,360,437 (GRCm39) H522Q probably damaging Het
Tmem88 C A 11: 69,288,602 (GRCm39) A106S probably damaging Het
Trappc14 C A 5: 138,259,191 (GRCm39) C434F probably damaging Het
Trim39 A G 17: 36,574,646 (GRCm39) L252S possibly damaging Het
Trim60 T A 8: 65,453,975 (GRCm39) E91D probably damaging Het
Trpm5 A G 7: 142,641,475 (GRCm39) I145T possibly damaging Het
Vmn2r107 A T 17: 20,595,729 (GRCm39) M761L probably benign Het
Wdr4 G A 17: 31,719,584 (GRCm39) probably benign Het
Wfs1 A T 5: 37,125,653 (GRCm39) S413T probably damaging Het
Wnt2 A T 6: 18,030,208 (GRCm39) W27R probably damaging Het
Zc3h3 A T 15: 75,651,158 (GRCm39) H687Q probably damaging Het
Zfp750 G A 11: 121,403,951 (GRCm39) P308L possibly damaging Het
Other mutations in Szt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Szt2 APN 4 118,241,447 (GRCm39) splice site probably benign
IGL01082:Szt2 APN 4 118,254,821 (GRCm39) missense probably damaging 1.00
IGL01348:Szt2 APN 4 118,250,821 (GRCm39) splice site probably benign
IGL01869:Szt2 APN 4 118,256,268 (GRCm39) missense possibly damaging 0.87
IGL01918:Szt2 APN 4 118,241,450 (GRCm39) splice site probably benign
IGL01951:Szt2 APN 4 118,233,690 (GRCm39) unclassified probably benign
IGL01971:Szt2 APN 4 118,244,152 (GRCm39) missense probably benign 0.01
IGL02047:Szt2 APN 4 118,233,834 (GRCm39) unclassified probably benign
IGL02092:Szt2 APN 4 118,220,529 (GRCm39) unclassified probably benign
IGL02120:Szt2 APN 4 118,245,761 (GRCm39) missense probably benign 0.01
IGL02210:Szt2 APN 4 118,247,020 (GRCm39) missense possibly damaging 0.95
IGL02435:Szt2 APN 4 118,248,020 (GRCm39) missense probably damaging 1.00
IGL02622:Szt2 APN 4 118,250,087 (GRCm39) missense probably damaging 0.96
IGL02666:Szt2 APN 4 118,231,252 (GRCm39) missense probably damaging 0.99
IGL02712:Szt2 APN 4 118,242,030 (GRCm39) missense probably benign 0.19
IGL02983:Szt2 APN 4 118,222,976 (GRCm39) unclassified probably benign
IGL03026:Szt2 APN 4 118,249,046 (GRCm39) missense probably benign 0.40
IGL03178:Szt2 APN 4 118,239,886 (GRCm39) missense unknown
IGL03233:Szt2 APN 4 118,229,726 (GRCm39) missense unknown
IGL03377:Szt2 APN 4 118,259,594 (GRCm39) splice site probably benign
IGL03387:Szt2 APN 4 118,221,922 (GRCm39) unclassified probably benign
PIT4687001:Szt2 UTSW 4 118,255,398 (GRCm39) missense possibly damaging 0.84
R0026:Szt2 UTSW 4 118,241,969 (GRCm39) missense possibly damaging 0.92
R0352:Szt2 UTSW 4 118,239,790 (GRCm39) missense unknown
R0396:Szt2 UTSW 4 118,233,544 (GRCm39) unclassified probably benign
R0504:Szt2 UTSW 4 118,230,149 (GRCm39) splice site probably null
R1033:Szt2 UTSW 4 118,244,303 (GRCm39) missense probably damaging 0.98
R1222:Szt2 UTSW 4 118,262,656 (GRCm39) missense possibly damaging 0.77
R1418:Szt2 UTSW 4 118,244,976 (GRCm39) missense probably benign 0.03
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1763:Szt2 UTSW 4 118,229,565 (GRCm39) missense unknown
R1772:Szt2 UTSW 4 118,262,714 (GRCm39) missense probably damaging 1.00
R1840:Szt2 UTSW 4 118,222,854 (GRCm39) unclassified probably benign
R1942:Szt2 UTSW 4 118,249,817 (GRCm39) missense probably benign 0.17
R1965:Szt2 UTSW 4 118,241,162 (GRCm39) missense probably benign 0.36
R1998:Szt2 UTSW 4 118,232,924 (GRCm39) critical splice donor site probably null
R2012:Szt2 UTSW 4 118,220,862 (GRCm39) unclassified probably benign
R2044:Szt2 UTSW 4 118,233,645 (GRCm39) nonsense probably null
R2066:Szt2 UTSW 4 118,231,177 (GRCm39) missense unknown
R2345:Szt2 UTSW 4 118,238,594 (GRCm39) missense unknown
R2857:Szt2 UTSW 4 118,226,599 (GRCm39) missense probably damaging 1.00
R3156:Szt2 UTSW 4 118,260,016 (GRCm39) critical splice donor site probably null
R3236:Szt2 UTSW 4 118,240,231 (GRCm39) splice site probably null
R3237:Szt2 UTSW 4 118,240,231 (GRCm39) splice site probably null
R3405:Szt2 UTSW 4 118,251,217 (GRCm39) missense probably benign 0.02
R3795:Szt2 UTSW 4 118,248,927 (GRCm39) missense probably damaging 1.00
R3878:Szt2 UTSW 4 118,247,782 (GRCm39) missense probably damaging 1.00
R3906:Szt2 UTSW 4 118,235,466 (GRCm39) unclassified probably benign
R4012:Szt2 UTSW 4 118,241,097 (GRCm39) missense probably benign 0.02
R4039:Szt2 UTSW 4 118,222,149 (GRCm39) unclassified probably benign
R4081:Szt2 UTSW 4 118,230,764 (GRCm39) splice site probably benign
R4298:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4299:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4432:Szt2 UTSW 4 118,241,428 (GRCm39) missense probably damaging 0.99
R4597:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R4657:Szt2 UTSW 4 118,254,866 (GRCm39) missense probably benign 0.06
R4663:Szt2 UTSW 4 118,234,881 (GRCm39) unclassified probably benign
R4670:Szt2 UTSW 4 118,233,026 (GRCm39) unclassified probably benign
R4704:Szt2 UTSW 4 118,251,026 (GRCm39) missense probably damaging 0.99
R4748:Szt2 UTSW 4 118,246,388 (GRCm39) nonsense probably null
R4786:Szt2 UTSW 4 118,256,259 (GRCm39) missense probably benign 0.20
R4809:Szt2 UTSW 4 118,246,182 (GRCm39) missense probably damaging 1.00
R4830:Szt2 UTSW 4 118,226,445 (GRCm39) missense unknown
R4944:Szt2 UTSW 4 118,245,866 (GRCm39) missense probably benign 0.03
R5077:Szt2 UTSW 4 118,226,813 (GRCm39) critical splice donor site probably null
R5121:Szt2 UTSW 4 118,242,641 (GRCm39) missense possibly damaging 0.92
R5140:Szt2 UTSW 4 118,244,178 (GRCm39) missense possibly damaging 0.46
R5169:Szt2 UTSW 4 118,247,027 (GRCm39) missense probably benign 0.26
R5198:Szt2 UTSW 4 118,245,519 (GRCm39) missense probably benign 0.03
R5433:Szt2 UTSW 4 118,232,663 (GRCm39) unclassified probably benign
R5625:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5628:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5630:Szt2 UTSW 4 118,250,102 (GRCm39) missense possibly damaging 0.83
R5808:Szt2 UTSW 4 118,229,810 (GRCm39) missense unknown
R5902:Szt2 UTSW 4 118,248,700 (GRCm39) missense probably benign 0.05
R6049:Szt2 UTSW 4 118,260,185 (GRCm39) missense probably damaging 0.99
R6066:Szt2 UTSW 4 118,229,171 (GRCm39) missense unknown
R6272:Szt2 UTSW 4 118,231,487 (GRCm39) unclassified probably benign
R6456:Szt2 UTSW 4 118,233,894 (GRCm39) unclassified probably benign
R6538:Szt2 UTSW 4 118,247,674 (GRCm39) splice site probably null
R6604:Szt2 UTSW 4 118,242,671 (GRCm39) missense probably benign 0.01
R6664:Szt2 UTSW 4 118,248,942 (GRCm39) missense probably damaging 1.00
R6834:Szt2 UTSW 4 118,245,522 (GRCm39) missense probably benign 0.01
R7109:Szt2 UTSW 4 118,232,676 (GRCm39) missense unknown
R7163:Szt2 UTSW 4 118,262,727 (GRCm39) missense possibly damaging 0.90
R7190:Szt2 UTSW 4 118,246,203 (GRCm39) missense probably damaging 0.98
R7289:Szt2 UTSW 4 118,233,075 (GRCm39) missense unknown
R7291:Szt2 UTSW 4 118,248,446 (GRCm39) missense probably damaging 0.98
R7383:Szt2 UTSW 4 118,222,411 (GRCm39) nonsense probably null
R7448:Szt2 UTSW 4 118,220,668 (GRCm39) missense unknown
R7637:Szt2 UTSW 4 118,251,025 (GRCm39) missense probably damaging 0.99
R7833:Szt2 UTSW 4 118,223,416 (GRCm39) missense unknown
R7896:Szt2 UTSW 4 118,260,110 (GRCm39) missense possibly damaging 0.62
R7923:Szt2 UTSW 4 118,231,037 (GRCm39) missense unknown
R8090:Szt2 UTSW 4 118,244,199 (GRCm39) splice site probably null
R8103:Szt2 UTSW 4 118,245,061 (GRCm39) missense possibly damaging 0.88
R8288:Szt2 UTSW 4 118,246,973 (GRCm39) missense probably damaging 0.96
R8309:Szt2 UTSW 4 118,232,679 (GRCm39) frame shift probably null
R8341:Szt2 UTSW 4 118,250,033 (GRCm39) missense possibly damaging 0.63
R8480:Szt2 UTSW 4 118,244,015 (GRCm39) missense probably benign 0.01
R8497:Szt2 UTSW 4 118,245,518 (GRCm39) missense possibly damaging 0.94
R8549:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R8768:Szt2 UTSW 4 118,226,613 (GRCm39) missense unknown
R8992:Szt2 UTSW 4 118,239,985 (GRCm39) splice site probably benign
R9001:Szt2 UTSW 4 118,235,529 (GRCm39) missense unknown
R9094:Szt2 UTSW 4 118,242,651 (GRCm39) missense possibly damaging 0.74
R9110:Szt2 UTSW 4 118,242,630 (GRCm39) missense possibly damaging 0.89
R9129:Szt2 UTSW 4 118,221,866 (GRCm39) missense unknown
R9184:Szt2 UTSW 4 118,241,726 (GRCm39) missense possibly damaging 0.92
R9186:Szt2 UTSW 4 118,242,288 (GRCm39) missense probably damaging 1.00
R9424:Szt2 UTSW 4 118,248,151 (GRCm39) missense probably damaging 1.00
R9598:Szt2 UTSW 4 118,266,358 (GRCm39) critical splice donor site probably null
X0023:Szt2 UTSW 4 118,229,601 (GRCm39) missense unknown
Z1176:Szt2 UTSW 4 118,251,173 (GRCm39) missense probably damaging 0.99
Z1177:Szt2 UTSW 4 118,248,411 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTGGCTTCGGGATAGAGC -3'
(R):5'- CCATTCACGGCTCAAGATGG -3'

Sequencing Primer
(F):5'- CTTCGGGATAGAGCTAGGGATG -3'
(R):5'- CTCAAGATGGGACCCAGCATG -3'
Posted On 2014-08-25