Incidental Mutation 'R2009:Dmp1'
ID219341
Institutional Source Beutler Lab
Gene Symbol Dmp1
Ensembl Gene ENSMUSG00000029307
Gene Namedentin matrix protein 1
Synonyms
MMRRC Submission 040018-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2009 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location104202613-104214102 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104212840 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 461 (S461G)
Ref Sequence ENSEMBL: ENSMUSP00000068053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066708]
Predicted Effect probably damaging
Transcript: ENSMUST00000066708
AA Change: S461G

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000068053
Gene: ENSMUSG00000029307
AA Change: S461G

DomainStartEndE-ValueType
Pfam:DMP1 1 503 9.8e-206 PFAM
Meta Mutation Damage Score 0.3442 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dentin matrix acidic phosphoprotein is an extracellular matrix protein and a member of the small integrin binding ligand N-linked glycoprotein family. This protein, which is critical for proper mineralization of bone and dentin, is present in diverse cells of bone and tooth tissues. The protein contains a large number of acidic domains, multiple phosphorylation sites, a functional arg-gly-asp cell attachment sequence, and a DNA binding domain. In undifferentiated osteoblasts it is primarily a nuclear protein that regulates the expression of osteoblast-specific genes. During osteoblast maturation the protein becomes phosphorylated and is exported to the extracellular matrix, where it orchestrates mineralized matrix formation. Mutations in the gene are known to cause autosomal recessive hypophosphatemia, a disease that manifests as rickets and osteomalacia. The gene structure is conserved in mammals. Two transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypophosphatemia, rickets, osteomalacia, renal phosphate-wasting, impaired osteocyte maturation, defective dentinogenesis, and severe alveolar bone and cementum defects leading to early periodontal breakdown. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 T A 9: 30,922,137 D34V probably benign Het
Adgrf1 A T 17: 43,321,221 R884* probably null Het
Adgrg7 T C 16: 56,761,873 T301A probably benign Het
Als2cr11b A T 1: 59,003,232 noncoding transcript Het
Arhgef17 A G 7: 100,881,781 I1366T probably damaging Het
BC037034 C A 5: 138,260,929 C434F probably damaging Het
C1s2 A T 6: 124,635,089 L112H probably damaging Het
Cfap74 G A 4: 155,420,267 R103H possibly damaging Het
Col7a1 A T 9: 108,968,875 probably null Het
Eif4g2 A T 7: 111,074,198 D753E probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etv4 T C 11: 101,774,237 D130G probably damaging Het
Gabbr2 A T 4: 46,734,119 I533N probably damaging Het
Gne T C 4: 44,055,273 E234G probably benign Het
Itga6 C A 2: 71,816,681 N78K probably benign Het
Lap3 C T 5: 45,493,557 T33M probably benign Het
Limd1 A G 9: 123,479,499 S88G probably benign Het
Lrp1 G T 10: 127,544,516 T3922K probably damaging Het
Map4k3 A G 17: 80,664,088 probably benign Het
Mib1 T C 18: 10,812,118 L263S probably damaging Het
Ncor1 T C 11: 62,325,601 S1474G probably benign Het
Nkapl A C 13: 21,467,437 S335R probably damaging Het
Nrg3 A G 14: 38,370,814 S605P probably damaging Het
Olfr248 G T 1: 174,391,429 R120L possibly damaging Het
Olfr549 A G 7: 102,554,944 Y220C probably damaging Het
Patj G A 4: 98,456,169 D577N probably damaging Het
Pfpl A C 19: 12,429,955 K523N possibly damaging Het
Pik3c2a A C 7: 116,364,503 L924R probably damaging Het
Pkd2l1 C A 19: 44,155,964 R278L probably benign Het
Prss2 A T 6: 41,523,976 I108F probably damaging Het
Rnase2b A G 14: 51,162,890 T143A possibly damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Sphk2 A T 7: 45,711,013 H522Q probably damaging Het
Szt2 A G 4: 118,378,064 probably null Het
Tmem88 C A 11: 69,397,776 A106S probably damaging Het
Trim39 A G 17: 36,263,754 L252S possibly damaging Het
Trim60 T A 8: 65,001,323 E91D probably damaging Het
Trpm5 A G 7: 143,087,738 I145T possibly damaging Het
Vmn2r107 A T 17: 20,375,467 M761L probably benign Het
Wdr4 G A 17: 31,500,610 probably benign Het
Wfs1 A T 5: 36,968,309 S413T probably damaging Het
Wnt2 A T 6: 18,030,209 W27R probably damaging Het
Zc3h3 A T 15: 75,779,309 H687Q probably damaging Het
Zfp750 G A 11: 121,513,125 P308L possibly damaging Het
Other mutations in Dmp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Dmp1 APN 5 104210155 splice site probably benign
IGL01063:Dmp1 APN 5 104207099 start codon destroyed probably null 0.73
IGL01599:Dmp1 APN 5 104212462 nonsense probably null
IGL01631:Dmp1 APN 5 104212868 missense probably benign 0.04
IGL01646:Dmp1 APN 5 104211865 missense probably damaging 1.00
IGL02611:Dmp1 APN 5 104212514 missense probably damaging 1.00
IGL02642:Dmp1 APN 5 104211670 missense probably damaging 0.97
choppers UTSW 5 104207125 missense probably damaging 1.00
R0197:Dmp1 UTSW 5 104207630 missense possibly damaging 0.82
R0494:Dmp1 UTSW 5 104212208 missense probably damaging 1.00
R0529:Dmp1 UTSW 5 104212226 missense probably benign 0.03
R0850:Dmp1 UTSW 5 104212787 missense possibly damaging 0.86
R0883:Dmp1 UTSW 5 104207630 missense possibly damaging 0.82
R1858:Dmp1 UTSW 5 104207630 missense possibly damaging 0.92
R1869:Dmp1 UTSW 5 104212076 missense probably damaging 1.00
R1995:Dmp1 UTSW 5 104209913 missense possibly damaging 0.60
R2004:Dmp1 UTSW 5 104211924 missense possibly damaging 0.73
R2870:Dmp1 UTSW 5 104212108 missense probably benign 0.05
R2870:Dmp1 UTSW 5 104212108 missense probably benign 0.05
R4716:Dmp1 UTSW 5 104212561 missense probably damaging 0.99
R5687:Dmp1 UTSW 5 104207086 start gained probably benign
R6331:Dmp1 UTSW 5 104207125 missense probably damaging 1.00
R6389:Dmp1 UTSW 5 104212922 missense probably damaging 1.00
R7006:Dmp1 UTSW 5 104212322 missense probably benign 0.02
R7103:Dmp1 UTSW 5 104211863 missense probably damaging 1.00
R7699:Dmp1 UTSW 5 104211724 missense probably damaging 1.00
R8181:Dmp1 UTSW 5 104211514 splice site probably null
R8350:Dmp1 UTSW 5 104212899 missense probably damaging 0.99
R8379:Dmp1 UTSW 5 104211705 nonsense probably null
R8450:Dmp1 UTSW 5 104212899 missense probably damaging 0.99
R8531:Dmp1 UTSW 5 104212403 missense probably damaging 1.00
Z1177:Dmp1 UTSW 5 104211652 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGAACACATTCTCCAGCTCAG -3'
(R):5'- CGTCCTGTGAGAGCCATTTC -3'

Sequencing Primer
(F):5'- TCTCCGAGGAGAGTCAGGAGTC -3'
(R):5'- CCTGTGAGAGCCATTTCTTAGACAAG -3'
Posted On2014-08-25