Incidental Mutation 'R1968:Csf1r'
ID219342
Institutional Source Beutler Lab
Gene Symbol Csf1r
Ensembl Gene ENSMUSG00000024621
Gene Namecolony stimulating factor 1 receptor
SynonymsFms, Fim-2, CD115, M-CSFR, CSF-1R, Csfmr
MMRRC Submission 039981-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock #R1968 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location61105572-61132149 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61112795 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 275 (I275L)
Ref Sequence ENSEMBL: ENSMUSP00000110923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025523] [ENSMUST00000115268]
PDB Structure
Structure of M-CSF bound to the first three domains of FMS [X-RAY DIFFRACTION]
Structure of mouse Interleukin-34 in complex with mouse FMS [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025523
AA Change: I275L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000025523
Gene: ENSMUSG00000024621
AA Change: I275L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 102 4.63e-8 SMART
IG 112 196 7.82e-6 SMART
IGc2 215 285 1.36e-5 SMART
IG 308 397 3.2e-2 SMART
IG_like 402 504 1.8e2 SMART
transmembrane domain 513 535 N/A INTRINSIC
TyrKc 580 908 1.45e-134 SMART
low complexity region 926 954 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115268
AA Change: I275L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000110923
Gene: ENSMUSG00000024621
AA Change: I275L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IG 27 102 4.63e-8 SMART
IG 112 196 7.82e-6 SMART
IGc2 215 285 1.36e-5 SMART
IG 308 397 3.2e-2 SMART
IG_like 402 504 1.8e2 SMART
transmembrane domain 513 535 N/A INTRINSIC
TyrKc 580 908 1.45e-134 SMART
low complexity region 926 954 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183458
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the receptor for colony stimulating factor 1, a cytokine which controls the production, differentiation, and function of macrophages. This receptor mediates most if not all of the biological effects of this cytokine. Ligand binding activates the receptor kinase through a process of oligomerization and transphosphorylation. The encoded protein is a tyrosine kinase transmembrane receptor and member of the CSF1/PDGF receptor family of tyrosine-protein kinases. Mutations in this gene have been associated with a predisposition to myeloid malignancy. The first intron of this gene contains a transcriptionally inactive ribosomal protein L7 processed pseudogene oriented in the opposite direction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit skeletal, sensory, and reproductive abnormalities associated with severe deficiencies in osteoclasts, macrophages, and brain microglia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,322,199 L528Q probably damaging Het
Adam18 T A 8: 24,646,447 T353S probably benign Het
Aldh1a3 A G 7: 66,411,500 probably null Het
Aldh3b2 T A 19: 3,980,705 M390K probably benign Het
Arhgap45 T C 10: 80,027,702 I793T probably damaging Het
Arsb A G 13: 93,807,559 M253V probably benign Het
Atcay T C 10: 81,212,478 D258G possibly damaging Het
Atf1 G T 15: 100,254,514 probably null Het
Atp1a4 C T 1: 172,240,164 E511K probably benign Het
Atp8a1 A G 5: 67,667,657 V777A probably benign Het
Baz1a T C 12: 54,900,337 T1173A possibly damaging Het
Bdh2 A T 3: 135,285,609 D15V probably benign Het
Cacna1e T C 1: 154,700,494 Y69C probably damaging Het
Caskin2 A G 11: 115,803,614 L387P probably benign Het
Cat T C 2: 103,484,989 E17G probably benign Het
Ccdc15 T C 9: 37,347,795 I54M probably benign Het
Cdhr1 T G 14: 37,079,725 I754L probably benign Het
Cep120 G A 18: 53,723,241 T368I probably benign Het
Cep126 C A 9: 8,100,908 D542Y probably damaging Het
Cep135 T C 5: 76,624,747 S660P possibly damaging Het
Cfap70 A T 14: 20,420,811 S455R possibly damaging Het
Chd8 A G 14: 52,220,993 M886T probably damaging Het
Ckap5 T C 2: 91,586,343 S1098P probably benign Het
Clec4e A T 6: 123,283,574 I204N probably damaging Het
Cntnap5c G A 17: 58,359,296 R1107H probably damaging Het
Cramp1l T C 17: 24,964,939 D1234G probably damaging Het
Cyp27a1 A G 1: 74,737,276 E457G probably benign Het
Cyp2d11 T C 15: 82,389,548 T410A probably benign Het
Cyp2d22 G C 15: 82,373,172 T264S probably benign Het
Cyr61 T C 3: 145,648,210 Y275C probably damaging Het
Daam2 G A 17: 49,483,060 R390W probably damaging Het
Decr2 T C 17: 26,083,079 S226G probably benign Het
Dennd6b T C 15: 89,190,341 D91G possibly damaging Het
Dglucy T C 12: 100,859,644 V515A possibly damaging Het
Dlg5 A T 14: 24,164,119 L734* probably null Het
Dopey2 A G 16: 93,782,419 N1690D probably damaging Het
Exoc5 A G 14: 49,034,890 Y356H probably benign Het
Fut7 T A 2: 25,425,726 V332D probably benign Het
Gm436 A G 4: 144,670,623 Y180H possibly damaging Het
Gnas T C 2: 174,298,733 S232P probably damaging Het
Gramd4 A G 15: 86,132,905 E522G probably damaging Het
Gys1 A G 7: 45,443,546 T297A probably damaging Het
Herc4 T C 10: 63,273,525 S180P probably benign Het
Hivep3 C T 4: 120,096,238 P584S possibly damaging Het
Itpk1 G T 12: 102,675,470 probably null Het
Jmjd1c A T 10: 67,225,440 S1191C probably damaging Het
Lima1 T C 15: 99,819,684 N147S probably benign Het
Lrmp T A 6: 145,169,773 S310T probably damaging Het
Map4k5 G A 12: 69,818,492 T506I probably damaging Het
Mat1a A T 14: 41,111,034 E58V probably damaging Het
Mfsd13a T C 19: 46,372,053 L348P probably damaging Het
Mon2 A G 10: 123,009,565 Y1413H probably damaging Het
Mpp3 C A 11: 102,018,552 probably benign Het
Mpp4 T A 1: 59,144,802 I260F probably damaging Het
Myocd C A 11: 65,200,907 G70C probably damaging Het
Nckap1 C T 2: 80,517,942 S889N probably benign Het
Nckap5 T A 1: 126,014,630 D209V probably damaging Het
Nlrp9a A G 7: 26,564,941 K707R probably benign Het
Npr3 A G 15: 11,904,969 L224S probably benign Het
Olfr1036 T A 2: 86,075,205 L155Q probably damaging Het
Olfr1153 T A 2: 87,897,039 V280E probably damaging Het
Olfr821 A G 10: 130,033,733 S36G probably damaging Het
Otof C T 5: 30,388,654 D467N probably damaging Het
Paxx T C 2: 25,460,628 probably benign Het
Pcmt1 G A 10: 7,640,710 R179* probably null Het
Phkb T A 8: 85,970,951 V463D probably benign Het
Prkcq T C 2: 11,245,397 V175A probably damaging Het
Rasl11b T G 5: 74,196,136 I58S probably damaging Het
Rb1cc1 A T 1: 6,248,195 probably null Het
Reck T A 4: 43,913,771 probably null Het
Riox1 G T 12: 83,951,382 D231Y probably damaging Het
Rlf T A 4: 121,148,420 N1231I probably damaging Het
Rpn1 A G 6: 88,095,548 D291G possibly damaging Het
Samsn1 C T 16: 75,945,573 noncoding transcript Het
Scara5 T C 14: 65,689,800 C49R possibly damaging Het
Serpini1 A G 3: 75,614,478 D92G probably benign Het
Setdb2 A T 14: 59,419,409 L153Q probably damaging Het
Sh3rf3 C T 10: 58,813,987 T138M probably benign Het
Shkbp1 C T 7: 27,355,400 probably null Het
Slc22a29 G A 19: 8,218,343 P111S probably benign Het
Smarca1 A G X: 47,852,687 V618A probably damaging Het
Spef2 T A 15: 9,609,516 M1308L probably damaging Het
Spink5 A G 18: 43,990,708 N354S probably benign Het
Srrm2 T C 17: 23,821,491 S2370P probably damaging Het
Ssxb3 A T X: 8,588,666 I28N probably damaging Het
Sucla2 A G 14: 73,593,679 T411A probably damaging Het
Tex38 A C 4: 115,780,340 S89A probably benign Het
Tjp2 A T 19: 24,111,073 D723E probably damaging Het
Tln2 A T 9: 67,255,901 N1121K probably damaging Het
Tti1 T C 2: 158,009,046 E91G possibly damaging Het
Wbp2 A T 11: 116,082,365 M72K possibly damaging Het
Wdfy4 C A 14: 33,106,044 C1062F possibly damaging Het
Wiz A G 17: 32,359,372 Y389H probably damaging Het
Zcchc3 T C 2: 152,414,092 K229R probably damaging Het
Zmat3 C A 3: 32,360,982 D60Y probably damaging Het
Other mutations in Csf1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01403:Csf1r APN 18 61114825 missense probably benign 0.08
IGL01603:Csf1r APN 18 61129301 missense probably damaging 1.00
IGL02377:Csf1r APN 18 61124468 splice site probably benign
IGL03000:Csf1r APN 18 61109652 missense probably damaging 0.97
IGL03011:Csf1r APN 18 61110401 missense probably benign 0.00
IGL03132:Csf1r APN 18 61128099 missense probably benign 0.03
IGL03189:Csf1r APN 18 61105986 missense probably benign 0.05
IGL03224:Csf1r APN 18 61112062 missense probably damaging 0.96
IGL03351:Csf1r APN 18 61117108 nonsense probably null
ANU74:Csf1r UTSW 18 61117391 missense probably benign 0.09
R1245:Csf1r UTSW 18 61114812 missense probably benign
R1363:Csf1r UTSW 18 61124845 missense possibly damaging 0.95
R1651:Csf1r UTSW 18 61110401 missense possibly damaging 0.64
R1785:Csf1r UTSW 18 61129077 missense probably damaging 0.98
R1786:Csf1r UTSW 18 61129077 missense probably damaging 0.98
R1902:Csf1r UTSW 18 61130141 missense probably damaging 0.99
R2177:Csf1r UTSW 18 61114943 splice site probably benign
R3743:Csf1r UTSW 18 61114774 missense probably benign 0.01
R3809:Csf1r UTSW 18 61112764 missense probably benign 0.22
R4374:Csf1r UTSW 18 61119006 missense probably damaging 0.99
R4683:Csf1r UTSW 18 61124911 missense probably damaging 1.00
R4973:Csf1r UTSW 18 61129047 missense probably damaging 1.00
R5080:Csf1r UTSW 18 61124301 missense probably damaging 1.00
R5314:Csf1r UTSW 18 61129724 missense probably damaging 1.00
R5936:Csf1r UTSW 18 61125808 missense probably damaging 1.00
R6015:Csf1r UTSW 18 61109712 missense possibly damaging 0.50
R6227:Csf1r UTSW 18 61125828 nonsense probably null
R6505:Csf1r UTSW 18 61129733 missense probably damaging 1.00
R6602:Csf1r UTSW 18 61110425 missense possibly damaging 0.81
R6811:Csf1r UTSW 18 61119053 missense probably damaging 1.00
R6813:Csf1r UTSW 18 61112734 missense probably benign
R7218:Csf1r UTSW 18 61130324 missense probably damaging 1.00
R7480:Csf1r UTSW 18 61117538 missense probably benign 0.06
R7752:Csf1r UTSW 18 61110296 missense probably damaging 1.00
R7762:Csf1r UTSW 18 61110500 missense probably benign 0.01
R7901:Csf1r UTSW 18 61110296 missense probably damaging 1.00
R7984:Csf1r UTSW 18 61110296 missense probably damaging 1.00
R8012:Csf1r UTSW 18 61117064 missense possibly damaging 0.86
R8043:Csf1r UTSW 18 61124875 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACTTTAACCGAGGGCAGG -3'
(R):5'- AGTTGAGTGTCTAGAAAGTCTCC -3'

Sequencing Primer
(F):5'- GCAATTGAGACTCAGAGTTCAGTCC -3'
(R):5'- CCTAAGTTGGAGCTCCTGGATTAAG -3'
Posted On2014-08-25