Incidental Mutation 'R2009:Prss2'
ID219349
Institutional Source Beutler Lab
Gene Symbol Prss2
Ensembl Gene ENSMUSG00000057163
Gene Nameprotease, serine 2
SynonymsTRYP, Tesp4, Ta, TRY8, Try2
MMRRC Submission 040018-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2009 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location41521787-41525079 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41523976 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 108 (I108F)
Ref Sequence ENSEMBL: ENSMUSP00000065393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070380]
Predicted Effect probably damaging
Transcript: ENSMUST00000070380
AA Change: I108F

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000065393
Gene: ENSMUSG00000057163
AA Change: I108F

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Tryp_SPc 23 239 5.29e-106 SMART
Meta Mutation Damage Score 0.4192 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the trypsin family of serine proteases and encodes anionic trypsinogen. It is part of a cluster of trypsinogen genes that are located within the T cell receptor beta locus. Enzymes of this family cleave peptide bonds that follow lysine or arginine residues. This protein is found at high levels in pancreatic juice and its upregulation is a characteristic feature of pancreatitis. This protein has also been found to activate pro-urokinase in ovarian tumors, suggesting a function in tumor invasion. In addition, this enzyme is able to cleave across the type II collagen triple helix in rheumatoid arthritis synovitis tissue, potentially participating in the degradation of type II collagen-rich cartilage matrix. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 T A 9: 30,922,137 D34V probably benign Het
Adgrf1 A T 17: 43,321,221 R884* probably null Het
Adgrg7 T C 16: 56,761,873 T301A probably benign Het
Als2cr11b A T 1: 59,003,232 noncoding transcript Het
Arhgef17 A G 7: 100,881,781 I1366T probably damaging Het
BC037034 C A 5: 138,260,929 C434F probably damaging Het
C1s2 A T 6: 124,635,089 L112H probably damaging Het
Cfap74 G A 4: 155,420,267 R103H possibly damaging Het
Col7a1 A T 9: 108,968,875 probably null Het
Dmp1 A G 5: 104,212,840 S461G probably damaging Het
Eif4g2 A T 7: 111,074,198 D753E probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etv4 T C 11: 101,774,237 D130G probably damaging Het
Gabbr2 A T 4: 46,734,119 I533N probably damaging Het
Gne T C 4: 44,055,273 E234G probably benign Het
Itga6 C A 2: 71,816,681 N78K probably benign Het
Lap3 C T 5: 45,493,557 T33M probably benign Het
Limd1 A G 9: 123,479,499 S88G probably benign Het
Lrp1 G T 10: 127,544,516 T3922K probably damaging Het
Map4k3 A G 17: 80,664,088 probably benign Het
Mib1 T C 18: 10,812,118 L263S probably damaging Het
Ncor1 T C 11: 62,325,601 S1474G probably benign Het
Nkapl A C 13: 21,467,437 S335R probably damaging Het
Nrg3 A G 14: 38,370,814 S605P probably damaging Het
Olfr248 G T 1: 174,391,429 R120L possibly damaging Het
Olfr549 A G 7: 102,554,944 Y220C probably damaging Het
Patj G A 4: 98,456,169 D577N probably damaging Het
Pfpl A C 19: 12,429,955 K523N possibly damaging Het
Pik3c2a A C 7: 116,364,503 L924R probably damaging Het
Pkd2l1 C A 19: 44,155,964 R278L probably benign Het
Rnase2b A G 14: 51,162,890 T143A possibly damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Sphk2 A T 7: 45,711,013 H522Q probably damaging Het
Szt2 A G 4: 118,378,064 probably null Het
Tmem88 C A 11: 69,397,776 A106S probably damaging Het
Trim39 A G 17: 36,263,754 L252S possibly damaging Het
Trim60 T A 8: 65,001,323 E91D probably damaging Het
Trpm5 A G 7: 143,087,738 I145T possibly damaging Het
Vmn2r107 A T 17: 20,375,467 M761L probably benign Het
Wdr4 G A 17: 31,500,610 probably benign Het
Wfs1 A T 5: 36,968,309 S413T probably damaging Het
Wnt2 A T 6: 18,030,209 W27R probably damaging Het
Zc3h3 A T 15: 75,779,309 H687Q probably damaging Het
Zfp750 G A 11: 121,513,125 P308L possibly damaging Het
Other mutations in Prss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01920:Prss2 APN 6 41524543 missense possibly damaging 0.54
R4471:Prss2 UTSW 6 41522846 missense probably damaging 0.97
R5728:Prss2 UTSW 6 41523917 missense probably benign 0.29
R6193:Prss2 UTSW 6 41521820 missense unknown
R6243:Prss2 UTSW 6 41524453 missense probably benign 0.00
R7793:Prss2 UTSW 6 41524952 missense possibly damaging 0.56
R8463:Prss2 UTSW 6 41521805 start codon destroyed probably null
Z1177:Prss2 UTSW 6 41523880 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AGAGCCACTCCTGAGCAAGAAG -3'
(R):5'- AGATAGATGCCTGGTTTTGGAAAAC -3'

Sequencing Primer
(F):5'- GCAAGAAGCTTGGGAACCCTG -3'
(R):5'- TTTTGGAAAACATGGGAAGGAAG -3'
Posted On2014-08-25