Incidental Mutation 'R1969:Pkhd1'
ID 219360
Institutional Source Beutler Lab
Gene Symbol Pkhd1
Ensembl Gene ENSMUSG00000043760
Gene Name polycystic kidney and hepatic disease 1
Synonyms FPC, tigmin
MMRRC Submission 039982-MU
Accession Numbers

Genbank: NM_153179; MGI: 2155808
Essential gene? Probably non essential (E-score: 0.086) question?
Stock # R1969 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 20057779-20618064 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20381523 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 2183 (I2183F)
Ref Sequence ENSEMBL: ENSMUSP00000085794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088448]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000088448
AA Change: I2183F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085794
Gene: ENSMUSG00000043760
AA Change: I2183F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:IPT 134 254 1e-45 BLAST
IPT 256 353 1.13e-3 SMART
low complexity region 722 743 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Pfam:TIG 936 1005 9.1e-8 PFAM
IPT 1016 1101 1.18e-6 SMART
IPT 1105 1190 1.27e0 SMART
IPT 1193 1290 7.05e-5 SMART
IPT 1384 1467 1.36e1 SMART
IPT 1568 1655 2.4e0 SMART
low complexity region 1881 1892 N/A INTRINSIC
G8 1928 2049 1.15e-48 SMART
low complexity region 2079 2094 N/A INTRINSIC
PbH1 2244 2266 7.82e3 SMART
PbH1 2287 2321 2.23e3 SMART
PbH1 2404 2426 7.19e2 SMART
PbH1 2459 2481 2.64e2 SMART
low complexity region 2713 2728 N/A INTRINSIC
G8 2734 2867 1.73e-43 SMART
Blast:G8 2876 2923 2e-17 BLAST
PbH1 3004 3026 3.98e3 SMART
PbH1 3027 3049 1.27e0 SMART
PbH1 3080 3102 5.92e2 SMART
low complexity region 3178 3187 N/A INTRINSIC
PbH1 3188 3212 8.08e3 SMART
transmembrane domain 3852 3874 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161509
Meta Mutation Damage Score 0.6147 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to have a single transmembrane (TM)-spanning domain and multiple copies of an immunoglobulin-like plexin-transcription-factor domain. Alternative splicing results in two transcript variants encoding different isoforms. Other alternatively spliced transcripts have been described, but the full length sequences have not been determined. Several of these transcripts are predicted to encode truncated products which lack the TM and may be secreted. Mutations in this gene cause autosomal recessive polycystic kidney disease, also known as polycystic kidney and hepatic disease-1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation in this gene display variable progressive liver cysts and fibrosis, but do not display kidney cysts and are fertile. Mice homozygous for a hypomorphic and null allele display renal, pancreatic, billiary and liver cysts. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(2) Targeted, other(4)
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T C 19: 21,598,245 probably benign Het
1700014D04Rik T C 13: 59,742,785 D407G probably damaging Het
9930021J03Rik C T 19: 29,716,675 S1873N possibly damaging Het
Apoh G A 11: 108,407,462 R196Q probably benign Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
B4galnt4 T C 7: 141,064,848 F194L probably benign Het
BC034090 A T 1: 155,225,226 L431M possibly damaging Het
Bdh2 G T 3: 135,288,279 A31S probably damaging Het
Cacna1s T C 1: 136,119,095 S1821P probably benign Het
Caskin1 A T 17: 24,506,850 Q1370L possibly damaging Het
Ccdc83 T A 7: 90,244,154 S132C probably damaging Het
Cdk15 A T 1: 59,330,951 H384L probably damaging Het
Col24a1 T C 3: 145,314,930 I354T probably benign Het
Coro7 T C 16: 4,633,756 I451V probably benign Het
Ctnna2 T C 6: 77,758,500 E65G probably damaging Het
Ctsll3 A T 13: 60,800,348 W172R probably benign Het
D230025D16Rik T A 8: 105,246,500 D247E possibly damaging Het
D630045J12Rik T C 6: 38,168,143 D1316G probably damaging Het
Ddx19b C T 8: 111,008,258 A493T probably benign Het
Ddx4 C T 13: 112,600,013 V608I probably damaging Het
Ddx4 T A 13: 112,620,742 H348L probably damaging Het
Dnah17 G C 11: 118,104,535 Q996E probably benign Het
Dnah9 G C 11: 65,848,371 N4180K probably damaging Het
Dok7 A G 5: 35,077,266 probably null Het
Dpf3 T A 12: 83,325,035 probably null Het
Elfn1 G C 5: 139,972,849 R536P probably damaging Het
Eml6 A G 11: 29,833,075 V602A probably benign Het
Enpp2 T C 15: 54,882,982 D296G probably damaging Het
Evi5 A T 5: 107,748,364 F738I probably benign Het
Eya2 T C 2: 165,716,119 S212P probably benign Het
Fam83a T C 15: 57,986,102 L14P probably damaging Het
Fanca A T 8: 123,288,064 M735K probably benign Het
Fancm T A 12: 65,101,692 S694T probably benign Het
Fibcd1 G A 2: 31,816,661 T386I probably damaging Het
Foxd4 A G 19: 24,899,814 S341P probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Fryl A T 5: 73,098,266 S807R probably benign Het
Fscb T C 12: 64,473,234 E486G unknown Het
Galnt17 A G 5: 131,150,944 S122P probably benign Het
Ghitm A G 14: 37,131,629 F85L probably benign Het
Ghrh C A 2: 157,333,466 V32L probably benign Het
Gli2 C T 1: 118,837,700 R907H probably benign Het
Gm11639 A G 11: 104,746,264 I988M probably damaging Het
Gm28042 A G 2: 120,041,615 *1015W probably null Het
Gpr179 T C 11: 97,337,958 T1124A probably benign Het
Grid2 C A 6: 63,908,918 C99* probably null Het
Grin1 A T 2: 25,297,915 M523K probably benign Het
Gucy2g T C 19: 55,222,896 Y634C possibly damaging Het
Gucy2g T G 19: 55,233,053 T339P probably benign Het
Haus6 A T 4: 86,604,246 L116H probably damaging Het
Hey1 T C 3: 8,666,819 T18A probably benign Het
Hipk3 T C 2: 104,433,841 N792D probably damaging Het
Il19 A T 1: 130,939,156 L29Q probably damaging Het
Il21r A G 7: 125,628,972 Q205R probably damaging Het
Kcnip2 T C 19: 45,793,683 D169G probably null Het
Kctd18 T C 1: 57,967,620 I24V probably benign Het
Lcp1 T C 14: 75,200,506 S119P probably damaging Het
Lig3 G C 11: 82,795,718 D642H probably benign Het
Lrba A G 3: 86,608,389 K2166E probably damaging Het
Lrrn2 T C 1: 132,939,234 V679A probably benign Het
Lyst G A 13: 13,730,344 R3202H probably damaging Het
Micall2 A G 5: 139,736,130 C11R probably damaging Het
Morc2b T G 17: 33,137,091 Q569P probably benign Het
Mtrf1 A G 14: 79,401,671 E81G probably damaging Het
Myh2 G T 11: 67,189,178 S1099I possibly damaging Het
Nap1l1 T A 10: 111,491,053 D158E probably benign Het
Nckap5l T A 15: 99,422,818 T1285S probably damaging Het
Nsrp1 A T 11: 77,045,786 M528K probably damaging Het
Numa1 C T 7: 102,009,322 A1605V probably damaging Het
Nutm2 T C 13: 50,473,842 L453P probably damaging Het
Ofd1 T C X: 166,427,214 Y205C probably benign Het
Olfr1233 T A 2: 89,340,296 N2I probably damaging Het
Olfr135 A G 17: 38,208,464 Y73C probably damaging Het
Olfr19 T A 16: 16,673,583 M133L probably benign Het
Olfr552 A T 7: 102,604,570 D72V probably damaging Het
Olfr693 T A 7: 106,677,670 N272I probably damaging Het
Patl1 T C 19: 11,921,418 L159P probably benign Het
Paxip1 G A 5: 27,744,136 T1045I probably damaging Het
Pik3ca A G 3: 32,451,754 probably null Het
Plec C T 15: 76,189,172 R319H probably damaging Het
Pnkd G A 1: 74,351,849 G334D probably damaging Het
Prss50 A G 9: 110,862,381 Y251C probably damaging Het
Rab11b A T 17: 33,760,235 Y10N probably damaging Het
Rfc1 G A 5: 65,319,524 R4W probably damaging Het
Rgs19 A T 2: 181,689,483 F119Y probably damaging Het
Safb A G 17: 56,605,821 H883R probably benign Het
Serpine1 G A 5: 137,067,747 Q227* probably null Het
Slc25a13 A G 6: 6,096,668 probably null Het
Slc6a18 T A 13: 73,664,189 T502S possibly damaging Het
Sox4 T C 13: 28,952,648 D125G probably damaging Het
Stag3 C T 5: 138,300,138 T731I probably damaging Het
Thada G T 17: 84,310,042 P1349T probably damaging Het
Tmem245 C A 4: 56,937,964 V195F probably benign Het
Tnxb A G 17: 34,679,081 H901R probably benign Het
Trim39 A T 17: 36,268,753 D103E probably benign Het
Ttn A T 2: 76,731,960 V28847E probably damaging Het
Tubb1 A T 2: 174,455,691 D31V possibly damaging Het
Ush1g A G 11: 115,318,454 S305P probably damaging Het
Vmn1r191 A T 13: 22,178,782 N267K possibly damaging Het
Vmn1r59 A T 7: 5,454,039 Y241N probably damaging Het
Vmn2r49 T C 7: 9,986,308 N419D probably damaging Het
Vps35 T C 8: 85,278,994 D326G possibly damaging Het
Xdh A G 17: 73,892,751 S1187P possibly damaging Het
Xpc A C 6: 91,501,025 probably null Het
Zfp273 T C 13: 67,825,163 Y104H probably damaging Het
Other mutations in Pkhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Pkhd1 APN 1 20566874 critical splice acceptor site probably null
IGL00687:Pkhd1 APN 1 20524070 missense probably benign 0.19
IGL00824:Pkhd1 APN 1 20081184 critical splice donor site probably null
IGL00870:Pkhd1 APN 1 20571390 missense probably damaging 1.00
IGL00911:Pkhd1 APN 1 20117747 missense probably benign 0.00
IGL01015:Pkhd1 APN 1 20523258 missense possibly damaging 0.95
IGL01025:Pkhd1 APN 1 20209176 missense probably benign 0.04
IGL01064:Pkhd1 APN 1 20534530 splice site probably benign
IGL01313:Pkhd1 APN 1 20201024 missense probably damaging 1.00
IGL01340:Pkhd1 APN 1 20522977 missense probably benign 0.01
IGL01352:Pkhd1 APN 1 20549715 missense probably benign 0.34
IGL01456:Pkhd1 APN 1 20199459 missense probably damaging 1.00
IGL01530:Pkhd1 APN 1 20559419 critical splice donor site probably null
IGL01557:Pkhd1 APN 1 20116979 missense possibly damaging 0.59
IGL01655:Pkhd1 APN 1 20534633 nonsense probably null
IGL01790:Pkhd1 APN 1 20558671 missense probably damaging 0.96
IGL01862:Pkhd1 APN 1 20358910 missense probably damaging 1.00
IGL01874:Pkhd1 APN 1 20103235 missense probably benign 0.32
IGL01901:Pkhd1 APN 1 20220083 missense probably benign 0.11
IGL01903:Pkhd1 APN 1 20198137 missense probably damaging 1.00
IGL01981:Pkhd1 APN 1 20523567 missense possibly damaging 0.64
IGL02068:Pkhd1 APN 1 20522747 missense probably damaging 1.00
IGL02083:Pkhd1 APN 1 20201227 missense probably damaging 1.00
IGL02084:Pkhd1 APN 1 20377399 missense probably damaging 1.00
IGL02126:Pkhd1 APN 1 20117195 missense probably damaging 1.00
IGL02136:Pkhd1 APN 1 20275615 missense probably damaging 1.00
IGL02255:Pkhd1 APN 1 20584101 missense probably damaging 1.00
IGL02272:Pkhd1 APN 1 20209260 missense probably damaging 1.00
IGL02308:Pkhd1 APN 1 20070376 critical splice donor site probably null
IGL02364:Pkhd1 APN 1 20200783 missense probably benign
IGL02389:Pkhd1 APN 1 20117720 missense probably damaging 0.99
IGL02394:Pkhd1 APN 1 20199486 missense possibly damaging 0.57
IGL02403:Pkhd1 APN 1 20562418 missense probably benign 0.01
IGL02415:Pkhd1 APN 1 20414421 missense probably damaging 1.00
IGL02415:Pkhd1 APN 1 20522759 missense probably damaging 1.00
IGL02455:Pkhd1 APN 1 20364201 missense probably damaging 1.00
IGL02502:Pkhd1 APN 1 20392165 missense probably damaging 1.00
IGL02511:Pkhd1 APN 1 20073507 missense possibly damaging 0.90
IGL02530:Pkhd1 APN 1 20117720 missense probably damaging 0.99
IGL02532:Pkhd1 APN 1 20117720 missense probably damaging 0.99
IGL02534:Pkhd1 APN 1 20117720 missense probably damaging 0.99
IGL02556:Pkhd1 APN 1 20310710 missense probably damaging 1.00
IGL02570:Pkhd1 APN 1 20520256 missense probably damaging 0.99
IGL02605:Pkhd1 APN 1 20550902 missense possibly damaging 0.66
IGL02641:Pkhd1 APN 1 20558752 missense possibly damaging 0.61
IGL02741:Pkhd1 APN 1 20220029 splice site probably benign
IGL02752:Pkhd1 APN 1 20553591 missense possibly damaging 0.57
IGL02890:Pkhd1 APN 1 20361011 missense probably damaging 1.00
IGL02959:Pkhd1 APN 1 20608416 nonsense probably null
IGL02960:Pkhd1 APN 1 20377446 missense possibly damaging 0.69
IGL02990:Pkhd1 APN 1 20522963 missense possibly damaging 0.52
IGL03037:Pkhd1 APN 1 20522699 missense probably benign 0.06
IGL03082:Pkhd1 APN 1 20565633 missense probably damaging 1.00
IGL03114:Pkhd1 APN 1 20198171 missense probably damaging 0.99
IGL03288:Pkhd1 APN 1 20201019 missense probably benign 0.01
IGL03328:Pkhd1 APN 1 20081300 splice site probably benign
IGL03375:Pkhd1 APN 1 20117023 missense probably damaging 1.00
IGL03380:Pkhd1 APN 1 20200670 missense probably damaging 1.00
0152:Pkhd1 UTSW 1 20522894 missense possibly damaging 0.46
IGL03046:Pkhd1 UTSW 1 20537365 missense possibly damaging 0.81
LCD18:Pkhd1 UTSW 1 20611414 intron probably benign
P0035:Pkhd1 UTSW 1 20117347 missense probably benign 0.00
PIT4260001:Pkhd1 UTSW 1 20222906 missense possibly damaging 0.51
R0063:Pkhd1 UTSW 1 20211950 missense probably benign 0.02
R0063:Pkhd1 UTSW 1 20211950 missense probably benign 0.02
R0071:Pkhd1 UTSW 1 20201344 missense probably benign 0.11
R0071:Pkhd1 UTSW 1 20201344 missense probably benign 0.11
R0094:Pkhd1 UTSW 1 20209246 missense probably damaging 1.00
R0094:Pkhd1 UTSW 1 20209246 missense probably damaging 1.00
R0103:Pkhd1 UTSW 1 20523359 missense probably benign 0.04
R0103:Pkhd1 UTSW 1 20523359 missense probably benign 0.04
R0105:Pkhd1 UTSW 1 20523732 nonsense probably null
R0105:Pkhd1 UTSW 1 20523732 nonsense probably null
R0115:Pkhd1 UTSW 1 20350490 missense probably damaging 1.00
R0193:Pkhd1 UTSW 1 20358917 missense probably damaging 1.00
R0245:Pkhd1 UTSW 1 20540400 missense probably benign 0.03
R0277:Pkhd1 UTSW 1 20275538 missense probably benign 0.04
R0310:Pkhd1 UTSW 1 20549822 splice site probably null
R0323:Pkhd1 UTSW 1 20275538 missense probably benign 0.04
R0395:Pkhd1 UTSW 1 20381547 missense probably benign 0.26
R0412:Pkhd1 UTSW 1 20117788 missense probably damaging 1.00
R0506:Pkhd1 UTSW 1 20559469 missense probably benign 0.00
R0512:Pkhd1 UTSW 1 20310514 splice site probably benign
R0550:Pkhd1 UTSW 1 20347223 missense probably null 1.00
R0584:Pkhd1 UTSW 1 20239436 nonsense probably null
R0586:Pkhd1 UTSW 1 20524111 missense probably benign 0.04
R0598:Pkhd1 UTSW 1 20200890 missense probably damaging 1.00
R0603:Pkhd1 UTSW 1 20117173 missense probably benign 0.05
R0634:Pkhd1 UTSW 1 20117474 missense probably damaging 1.00
R0677:Pkhd1 UTSW 1 20524230 missense probably benign 0.01
R0746:Pkhd1 UTSW 1 20198107 missense probably damaging 1.00
R0781:Pkhd1 UTSW 1 20117484 missense probably benign 0.01
R0840:Pkhd1 UTSW 1 20350521 missense probably damaging 0.98
R0946:Pkhd1 UTSW 1 20199381 missense probably benign 0.10
R1018:Pkhd1 UTSW 1 20201259 missense possibly damaging 0.89
R1028:Pkhd1 UTSW 1 20117726 missense probably damaging 1.00
R1136:Pkhd1 UTSW 1 20522829 missense possibly damaging 0.68
R1178:Pkhd1 UTSW 1 20585157 critical splice donor site probably null
R1180:Pkhd1 UTSW 1 20585157 critical splice donor site probably null
R1222:Pkhd1 UTSW 1 20567456 missense probably benign 0.07
R1334:Pkhd1 UTSW 1 20533905 missense possibly damaging 0.81
R1335:Pkhd1 UTSW 1 20571405 missense probably damaging 1.00
R1387:Pkhd1 UTSW 1 20555223 splice site probably benign
R1411:Pkhd1 UTSW 1 20373896 missense probably damaging 1.00
R1443:Pkhd1 UTSW 1 20534558 missense probably damaging 1.00
R1448:Pkhd1 UTSW 1 20585157 critical splice donor site probably null
R1468:Pkhd1 UTSW 1 20523341 missense probably damaging 1.00
R1468:Pkhd1 UTSW 1 20523341 missense probably damaging 1.00
R1473:Pkhd1 UTSW 1 20522983 missense probably benign 0.00
R1524:Pkhd1 UTSW 1 20117780 missense probably damaging 1.00
R1532:Pkhd1 UTSW 1 20117401 missense probably benign 0.08
R1565:Pkhd1 UTSW 1 20347457 missense probably damaging 1.00
R1572:Pkhd1 UTSW 1 20347440 missense probably benign 0.02
R1583:Pkhd1 UTSW 1 20117825 missense probably benign
R1617:Pkhd1 UTSW 1 20198050 missense possibly damaging 0.95
R1631:Pkhd1 UTSW 1 20522897 missense probably benign 0.06
R1655:Pkhd1 UTSW 1 20584129 missense probably damaging 1.00
R1707:Pkhd1 UTSW 1 20550840 splice site probably benign
R1753:Pkhd1 UTSW 1 20533905 missense possibly damaging 0.81
R1782:Pkhd1 UTSW 1 20565711 missense probably damaging 0.98
R1791:Pkhd1 UTSW 1 20585152 splice site probably benign
R1822:Pkhd1 UTSW 1 20347457 missense probably damaging 1.00
R1823:Pkhd1 UTSW 1 20347457 missense probably damaging 1.00
R1824:Pkhd1 UTSW 1 20347457 missense probably damaging 1.00
R1836:Pkhd1 UTSW 1 20117069 missense probably benign 0.01
R1862:Pkhd1 UTSW 1 20551020 missense probably benign 0.00
R1863:Pkhd1 UTSW 1 20551020 missense probably benign 0.00
R1869:Pkhd1 UTSW 1 20615267 critical splice donor site probably null
R1913:Pkhd1 UTSW 1 20566756 critical splice donor site probably null
R1928:Pkhd1 UTSW 1 20081300 splice site probably benign
R1970:Pkhd1 UTSW 1 20381523 missense probably damaging 1.00
R1981:Pkhd1 UTSW 1 20117060 missense probably benign 0.00
R2008:Pkhd1 UTSW 1 20199459 missense probably damaging 0.99
R2034:Pkhd1 UTSW 1 20200669 missense probably damaging 1.00
R2061:Pkhd1 UTSW 1 20612812 missense possibly damaging 0.76
R2062:Pkhd1 UTSW 1 20201335 missense probably damaging 0.97
R2108:Pkhd1 UTSW 1 20553574 nonsense probably null
R2142:Pkhd1 UTSW 1 20523895 missense probably benign 0.00
R2148:Pkhd1 UTSW 1 20414220 critical splice donor site probably null
R2176:Pkhd1 UTSW 1 20553517 missense probably damaging 1.00
R2202:Pkhd1 UTSW 1 20537360 missense probably benign 0.06
R2255:Pkhd1 UTSW 1 20565639 missense probably benign 0.23
R2269:Pkhd1 UTSW 1 20534535 critical splice donor site probably null
R2275:Pkhd1 UTSW 1 20200849 missense possibly damaging 0.95
R2340:Pkhd1 UTSW 1 20200855 missense probably damaging 1.00
R2431:Pkhd1 UTSW 1 20201165 missense possibly damaging 0.63
R2679:Pkhd1 UTSW 1 20209182 missense probably benign 0.03
R2850:Pkhd1 UTSW 1 20509076 missense possibly damaging 0.89
R2851:Pkhd1 UTSW 1 20058302 missense probably benign 0.16
R2853:Pkhd1 UTSW 1 20058302 missense probably benign 0.16
R2984:Pkhd1 UTSW 1 20222961 missense possibly damaging 0.84
R2987:Pkhd1 UTSW 1 20104599 missense possibly damaging 0.87
R3692:Pkhd1 UTSW 1 20555129 missense possibly damaging 0.87
R3721:Pkhd1 UTSW 1 20585655 missense probably benign 0.08
R3746:Pkhd1 UTSW 1 20058300 makesense probably null
R3838:Pkhd1 UTSW 1 20534629 missense possibly damaging 0.66
R3843:Pkhd1 UTSW 1 20558723 missense probably benign 0.00
R3861:Pkhd1 UTSW 1 20200927 missense probably damaging 1.00
R3893:Pkhd1 UTSW 1 20312138 nonsense probably null
R3926:Pkhd1 UTSW 1 20550873 missense probably benign 0.00
R4183:Pkhd1 UTSW 1 20117807 missense probably benign 0.03
R4184:Pkhd1 UTSW 1 20209277 missense probably benign 0.03
R4184:Pkhd1 UTSW 1 20563686 missense probably benign 0.06
R4255:Pkhd1 UTSW 1 20593934 missense probably damaging 0.99
R4275:Pkhd1 UTSW 1 20058384 missense probably benign 0.00
R4342:Pkhd1 UTSW 1 20058617 missense probably benign 0.00
R4386:Pkhd1 UTSW 1 20414292 missense probably benign 0.00
R4402:Pkhd1 UTSW 1 20239411 missense probably damaging 1.00
R4431:Pkhd1 UTSW 1 20523314 missense probably damaging 0.99
R4560:Pkhd1 UTSW 1 20211858 missense probably damaging 1.00
R4561:Pkhd1 UTSW 1 20534719 missense possibly damaging 0.89
R4570:Pkhd1 UTSW 1 20381523 missense probably damaging 1.00
R4571:Pkhd1 UTSW 1 20613409 missense probably damaging 1.00
R4588:Pkhd1 UTSW 1 20200868 missense probably benign 0.00
R4598:Pkhd1 UTSW 1 20503056 missense probably damaging 1.00
R4651:Pkhd1 UTSW 1 20381523 missense probably damaging 1.00
R4657:Pkhd1 UTSW 1 20364167 missense possibly damaging 0.89
R4718:Pkhd1 UTSW 1 20081228 missense probably damaging 1.00
R4740:Pkhd1 UTSW 1 20524130 missense probably benign
R4750:Pkhd1 UTSW 1 20524112 missense possibly damaging 0.57
R4816:Pkhd1 UTSW 1 20199415 missense probably damaging 0.99
R4825:Pkhd1 UTSW 1 20537401 missense probably damaging 0.96
R4885:Pkhd1 UTSW 1 20070488 missense possibly damaging 0.55
R4907:Pkhd1 UTSW 1 20209226 missense probably damaging 1.00
R4944:Pkhd1 UTSW 1 20288205 missense probably null 0.01
R5062:Pkhd1 UTSW 1 20585711 missense probably benign 0.00
R5090:Pkhd1 UTSW 1 20200757 missense probably damaging 1.00
R5104:Pkhd1 UTSW 1 20585191 missense probably damaging 1.00
R5187:Pkhd1 UTSW 1 20209224 missense possibly damaging 0.67
R5202:Pkhd1 UTSW 1 20547341 missense probably benign 0.01
R5240:Pkhd1 UTSW 1 20275641 missense probably benign 0.04
R5248:Pkhd1 UTSW 1 20534545 missense probably benign 0.00
R5252:Pkhd1 UTSW 1 20350411 critical splice donor site probably null
R5293:Pkhd1 UTSW 1 20509076 missense possibly damaging 0.89
R5311:Pkhd1 UTSW 1 20565870 missense possibly damaging 0.94
R5317:Pkhd1 UTSW 1 20450304 missense probably damaging 1.00
R5346:Pkhd1 UTSW 1 20392097 missense probably benign
R5346:Pkhd1 UTSW 1 20523434 missense probably damaging 0.96
R5431:Pkhd1 UTSW 1 20117836 missense probably benign 0.25
R5447:Pkhd1 UTSW 1 20239385 missense probably benign 0.00
R5478:Pkhd1 UTSW 1 20201156 missense probably damaging 1.00
R5497:Pkhd1 UTSW 1 20377404 missense possibly damaging 0.94
R5554:Pkhd1 UTSW 1 20081252 missense probably damaging 0.99
R5579:Pkhd1 UTSW 1 20523142 missense probably damaging 0.96
R5614:Pkhd1 UTSW 1 20073526 missense possibly damaging 0.83
R5648:Pkhd1 UTSW 1 20558626 missense probably benign 0.04
R5651:Pkhd1 UTSW 1 20117807 missense probably benign 0.03
R5665:Pkhd1 UTSW 1 20588531 missense probably damaging 1.00
R5681:Pkhd1 UTSW 1 20547461 missense possibly damaging 0.61
R5754:Pkhd1 UTSW 1 20523651 nonsense probably null
R5760:Pkhd1 UTSW 1 20073554 missense probably benign 0.02
R5776:Pkhd1 UTSW 1 20209185 missense possibly damaging 0.62
R5782:Pkhd1 UTSW 1 20058600 missense probably benign
R5810:Pkhd1 UTSW 1 20200673 missense probably benign 0.26
R5814:Pkhd1 UTSW 1 20199405 missense probably damaging 1.00
R5816:Pkhd1 UTSW 1 20058678 missense probably benign 0.03
R5835:Pkhd1 UTSW 1 20201083 missense probably benign 0.01
R5844:Pkhd1 UTSW 1 20381461 missense probably benign 0.00
R5847:Pkhd1 UTSW 1 20374736 nonsense probably null
R5852:Pkhd1 UTSW 1 20377408 missense probably benign 0.22
R5863:Pkhd1 UTSW 1 20520210 missense possibly damaging 0.63
R6213:Pkhd1 UTSW 1 20523770 missense possibly damaging 0.80
R6351:Pkhd1 UTSW 1 20211951 missense probably benign 0.00
R6386:Pkhd1 UTSW 1 20551020 missense probably damaging 0.96
R6542:Pkhd1 UTSW 1 20585703 missense probably benign 0.02
R6579:Pkhd1 UTSW 1 20200823 missense probably benign 0.01
R6658:Pkhd1 UTSW 1 20612705 missense probably damaging 1.00
R6765:Pkhd1 UTSW 1 20058339 missense probably benign
R6886:Pkhd1 UTSW 1 20347280 missense probably benign 0.01
R6892:Pkhd1 UTSW 1 20523515 missense probably damaging 1.00
R6900:Pkhd1 UTSW 1 20534701 missense probably benign 0.06
R6932:Pkhd1 UTSW 1 20562451 missense probably benign 0.19
R7191:Pkhd1 UTSW 1 20558719 missense probably benign 0.00
R7220:Pkhd1 UTSW 1 20523126 missense possibly damaging 0.89
R7329:Pkhd1 UTSW 1 20547519 missense probably damaging 0.96
R7361:Pkhd1 UTSW 1 20593953 missense probably damaging 1.00
R7381:Pkhd1 UTSW 1 20200973 missense probably damaging 1.00
R7388:Pkhd1 UTSW 1 20239304 missense not run
R7436:Pkhd1 UTSW 1 20200701 missense probably benign
R7473:Pkhd1 UTSW 1 20549756 missense probably damaging 0.99
R7578:Pkhd1 UTSW 1 20347361 missense probably damaging 1.00
R7751:Pkhd1 UTSW 1 20200925 missense probably damaging 1.00
R7755:Pkhd1 UTSW 1 20547493 missense probably damaging 0.98
R7757:Pkhd1 UTSW 1 20562415 missense probably damaging 1.00
R7832:Pkhd1 UTSW 1 20502999 missense probably damaging 1.00
R7834:Pkhd1 UTSW 1 20312049 missense probably benign
R7920:Pkhd1 UTSW 1 20275535 missense probably damaging 1.00
R8014:Pkhd1 UTSW 1 20508891 critical splice donor site probably null
R8034:Pkhd1 UTSW 1 20381438 missense possibly damaging 0.94
R8085:Pkhd1 UTSW 1 20613415 missense probably damaging 1.00
R8087:Pkhd1 UTSW 1 20523089 missense probably damaging 1.00
R8103:Pkhd1 UTSW 1 20200757 missense probably damaging 1.00
R8122:Pkhd1 UTSW 1 20562458 missense probably damaging 1.00
R8273:Pkhd1 UTSW 1 20537420 splice site probably benign
R8485:Pkhd1 UTSW 1 20523033 missense probably damaging 1.00
R8504:Pkhd1 UTSW 1 20520208 missense probably benign 0.10
R8544:Pkhd1 UTSW 1 20522975 missense probably damaging 1.00
R8692:Pkhd1 UTSW 1 20392150 missense probably damaging 1.00
R8787:Pkhd1 UTSW 1 20288237 missense probably damaging 0.99
R8853:Pkhd1 UTSW 1 20073455 critical splice donor site probably null
R8907:Pkhd1 UTSW 1 20117561 missense possibly damaging 0.88
R8934:Pkhd1 UTSW 1 20392010 critical splice donor site probably null
R8990:Pkhd1 UTSW 1 20347305 missense probably benign 0.00
R8998:Pkhd1 UTSW 1 20364201 missense probably damaging 1.00
R9024:Pkhd1 UTSW 1 20522751 missense probably benign 0.24
R9035:Pkhd1 UTSW 1 20502952 missense probably damaging 1.00
R9092:Pkhd1 UTSW 1 20562362 missense probably benign 0.00
R9238:Pkhd1 UTSW 1 20534575 missense possibly damaging 0.89
R9258:Pkhd1 UTSW 1 20373950 missense probably damaging 0.99
R9262:Pkhd1 UTSW 1 20548127 missense probably benign 0.01
R9297:Pkhd1 UTSW 1 20222894 missense probably benign 0.06
R9452:Pkhd1 UTSW 1 20612729 missense possibly damaging 0.77
R9515:Pkhd1 UTSW 1 20567517 missense probably damaging 1.00
R9540:Pkhd1 UTSW 1 20199346 missense probably benign 0.00
R9542:Pkhd1 UTSW 1 20117780 missense probably damaging 1.00
R9629:Pkhd1 UTSW 1 20392213 missense possibly damaging 0.63
R9644:Pkhd1 UTSW 1 20547466 missense probably benign 0.04
R9739:Pkhd1 UTSW 1 20350484 missense probably damaging 1.00
R9767:Pkhd1 UTSW 1 20414412 missense probably benign
R9781:Pkhd1 UTSW 1 20117441 missense possibly damaging 0.95
R9803:Pkhd1 UTSW 1 20566849 missense probably damaging 1.00
X0012:Pkhd1 UTSW 1 20373926 missense probably damaging 1.00
X0067:Pkhd1 UTSW 1 20520226 missense probably damaging 1.00
Z1176:Pkhd1 UTSW 1 20523747 missense possibly damaging 0.81
Z1177:Pkhd1 UTSW 1 20117883 missense probably damaging 1.00
Z1177:Pkhd1 UTSW 1 20310594 missense probably damaging 1.00
Z1177:Pkhd1 UTSW 1 20523621 missense probably damaging 1.00
Z1177:Pkhd1 UTSW 1 20523938 missense probably damaging 1.00
Z1177:Pkhd1 UTSW 1 20551019 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATCGTGTGGTATCATCAACATAG -3'
(R):5'- GCAAGGGCCAGTATCATGTC -3'

Sequencing Primer
(F):5'- GTGTGGTATCATCAACATAGAAGAAG -3'
(R):5'- GGCCAGTATCATGTCCTAGAAATTTG -3'
Posted On 2014-08-25