Incidental Mutation 'R2009:Espl1'
ID 219393
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Name extra spindle pole bodies 1, separase
Synonyms ESP1, SSE, separase, PRCE, Cerp, PRCE
MMRRC Submission 040018-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2009 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 102204701-102232792 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 102221424 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 944 (I944V)
Ref Sequence ENSEMBL: ENSMUSP00000155304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]
AlphaFold P60330
Predicted Effect probably damaging
Transcript: ENSMUST00000064924
AA Change: I944V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: I944V

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000229050
AA Change: I944V

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230120
Meta Mutation Damage Score 0.1426 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 T A 9: 30,833,433 (GRCm39) D34V probably benign Het
Adgrf1 A T 17: 43,632,112 (GRCm39) R884* probably null Het
Adgrg7 T C 16: 56,582,236 (GRCm39) T301A probably benign Het
Arhgef17 A G 7: 100,530,988 (GRCm39) I1366T probably damaging Het
C1s2 A T 6: 124,612,048 (GRCm39) L112H probably damaging Het
C2cd6 A T 1: 59,042,391 (GRCm39) noncoding transcript Het
Cfap74 G A 4: 155,504,724 (GRCm39) R103H possibly damaging Het
Col7a1 A T 9: 108,797,943 (GRCm39) probably null Het
Dmp1 A G 5: 104,360,706 (GRCm39) S461G probably damaging Het
Eif4g2 A T 7: 110,673,405 (GRCm39) D753E probably benign Het
Etv4 T C 11: 101,665,063 (GRCm39) D130G probably damaging Het
Gabbr2 A T 4: 46,734,119 (GRCm39) I533N probably damaging Het
Gne T C 4: 44,055,273 (GRCm39) E234G probably benign Het
Itga6 C A 2: 71,647,025 (GRCm39) N78K probably benign Het
Lap3 C T 5: 45,650,899 (GRCm39) T33M probably benign Het
Limd1 A G 9: 123,308,564 (GRCm39) S88G probably benign Het
Lrp1 G T 10: 127,380,385 (GRCm39) T3922K probably damaging Het
Map4k3 A G 17: 80,971,517 (GRCm39) probably benign Het
Mib1 T C 18: 10,812,118 (GRCm39) L263S probably damaging Het
Ncor1 T C 11: 62,216,427 (GRCm39) S1474G probably benign Het
Nkapl A C 13: 21,651,607 (GRCm39) S335R probably damaging Het
Nrg3 A G 14: 38,092,771 (GRCm39) S605P probably damaging Het
Or10x4 G T 1: 174,218,995 (GRCm39) R120L possibly damaging Het
Or52b3 A G 7: 102,204,151 (GRCm39) Y220C probably damaging Het
Patj G A 4: 98,344,406 (GRCm39) D577N probably damaging Het
Pfpl A C 19: 12,407,319 (GRCm39) K523N possibly damaging Het
Pik3c2a A C 7: 115,963,738 (GRCm39) L924R probably damaging Het
Pkd2l1 C A 19: 44,144,403 (GRCm39) R278L probably benign Het
Prss2 A T 6: 41,500,910 (GRCm39) I108F probably damaging Het
Rnase2b A G 14: 51,400,347 (GRCm39) T143A possibly damaging Het
Sgk1 C T 10: 21,872,500 (GRCm39) R171W probably damaging Het
Sphk2 A T 7: 45,360,437 (GRCm39) H522Q probably damaging Het
Szt2 A G 4: 118,235,261 (GRCm39) probably null Het
Tmem88 C A 11: 69,288,602 (GRCm39) A106S probably damaging Het
Trappc14 C A 5: 138,259,191 (GRCm39) C434F probably damaging Het
Trim39 A G 17: 36,574,646 (GRCm39) L252S possibly damaging Het
Trim60 T A 8: 65,453,975 (GRCm39) E91D probably damaging Het
Trpm5 A G 7: 142,641,475 (GRCm39) I145T possibly damaging Het
Vmn2r107 A T 17: 20,595,729 (GRCm39) M761L probably benign Het
Wdr4 G A 17: 31,719,584 (GRCm39) probably benign Het
Wfs1 A T 5: 37,125,653 (GRCm39) S413T probably damaging Het
Wnt2 A T 6: 18,030,208 (GRCm39) W27R probably damaging Het
Zc3h3 A T 15: 75,651,158 (GRCm39) H687Q probably damaging Het
Zfp750 G A 11: 121,403,951 (GRCm39) P308L possibly damaging Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102,208,248 (GRCm39) missense probably damaging 1.00
IGL00839:Espl1 APN 15 102,228,982 (GRCm39) unclassified probably benign
IGL00919:Espl1 APN 15 102,207,064 (GRCm39) missense probably benign 0.03
IGL01125:Espl1 APN 15 102,231,373 (GRCm39) missense probably damaging 1.00
IGL01366:Espl1 APN 15 102,228,271 (GRCm39) missense probably benign 0.00
IGL01488:Espl1 APN 15 102,207,174 (GRCm39) missense probably benign
IGL01554:Espl1 APN 15 102,221,660 (GRCm39) missense probably damaging 1.00
IGL01810:Espl1 APN 15 102,206,640 (GRCm39) missense probably benign
IGL01959:Espl1 APN 15 102,214,097 (GRCm39) splice site probably benign
IGL02267:Espl1 APN 15 102,224,099 (GRCm39) missense probably benign 0.01
IGL02452:Espl1 APN 15 102,208,274 (GRCm39) missense probably damaging 1.00
IGL02469:Espl1 APN 15 102,222,460 (GRCm39) missense probably damaging 1.00
IGL02500:Espl1 APN 15 102,224,235 (GRCm39) missense probably benign
IGL02630:Espl1 APN 15 102,205,253 (GRCm39) missense probably benign 0.11
IGL02687:Espl1 APN 15 102,221,613 (GRCm39) splice site probably benign
IGL02868:Espl1 APN 15 102,222,425 (GRCm39) nonsense probably null
IGL02926:Espl1 APN 15 102,208,290 (GRCm39) missense probably damaging 0.99
R0019:Espl1 UTSW 15 102,214,754 (GRCm39) missense probably null 0.01
R0129:Espl1 UTSW 15 102,225,083 (GRCm39) missense probably benign 0.00
R0184:Espl1 UTSW 15 102,207,651 (GRCm39) missense probably benign 0.01
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0240:Espl1 UTSW 15 102,220,976 (GRCm39) missense probably benign 0.00
R0267:Espl1 UTSW 15 102,221,452 (GRCm39) missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102,212,421 (GRCm39) nonsense probably null
R0587:Espl1 UTSW 15 102,212,382 (GRCm39) splice site probably benign
R0726:Espl1 UTSW 15 102,231,033 (GRCm39) missense probably benign
R1186:Espl1 UTSW 15 102,212,474 (GRCm39) missense probably benign 0.05
R1282:Espl1 UTSW 15 102,223,826 (GRCm39) missense probably benign 0.00
R1428:Espl1 UTSW 15 102,214,120 (GRCm39) missense probably benign 0.06
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1467:Espl1 UTSW 15 102,228,293 (GRCm39) missense probably benign 0.09
R1473:Espl1 UTSW 15 102,228,878 (GRCm39) missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102,206,802 (GRCm39) missense probably damaging 0.98
R1639:Espl1 UTSW 15 102,229,149 (GRCm39) missense probably damaging 1.00
R1725:Espl1 UTSW 15 102,221,656 (GRCm39) missense probably benign 0.08
R1748:Espl1 UTSW 15 102,206,964 (GRCm39) missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102,207,448 (GRCm39) missense probably benign
R1938:Espl1 UTSW 15 102,213,477 (GRCm39) missense probably benign 0.00
R1954:Espl1 UTSW 15 102,206,823 (GRCm39) missense probably damaging 1.00
R2014:Espl1 UTSW 15 102,231,149 (GRCm39) nonsense probably null
R2067:Espl1 UTSW 15 102,207,525 (GRCm39) missense probably damaging 0.96
R2084:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R2164:Espl1 UTSW 15 102,228,023 (GRCm39) missense probably damaging 1.00
R2204:Espl1 UTSW 15 102,214,340 (GRCm39) missense probably damaging 1.00
R2220:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R2237:Espl1 UTSW 15 102,224,004 (GRCm39) missense probably damaging 0.98
R2314:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3107:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3108:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3114:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102,231,639 (GRCm39) missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3616:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3732:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3733:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3958:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3959:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R3960:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4062:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4063:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4064:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4165:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4166:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4349:Espl1 UTSW 15 102,228,039 (GRCm39) missense probably benign 0.26
R4373:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4376:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4377:Espl1 UTSW 15 102,221,424 (GRCm39) missense probably damaging 0.99
R4516:Espl1 UTSW 15 102,231,671 (GRCm39) missense probably benign 0.00
R4595:Espl1 UTSW 15 102,207,159 (GRCm39) missense probably benign 0.01
R4884:Espl1 UTSW 15 102,232,505 (GRCm39) missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102,230,758 (GRCm39) critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102,223,676 (GRCm39) missense probably damaging 0.98
R4931:Espl1 UTSW 15 102,214,165 (GRCm39) missense probably benign 0.02
R4936:Espl1 UTSW 15 102,213,372 (GRCm39) missense probably damaging 1.00
R5000:Espl1 UTSW 15 102,206,986 (GRCm39) missense probably damaging 1.00
R5220:Espl1 UTSW 15 102,207,012 (GRCm39) missense probably benign 0.03
R5329:Espl1 UTSW 15 102,220,953 (GRCm39) missense probably damaging 0.97
R5501:Espl1 UTSW 15 102,225,565 (GRCm39) missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102,232,465 (GRCm39) missense probably damaging 1.00
R5848:Espl1 UTSW 15 102,231,011 (GRCm39) missense probably benign 0.03
R5906:Espl1 UTSW 15 102,205,286 (GRCm39) critical splice donor site probably null
R5978:Espl1 UTSW 15 102,224,209 (GRCm39) missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102,208,323 (GRCm39) missense probably damaging 0.99
R6313:Espl1 UTSW 15 102,224,247 (GRCm39) missense probably benign 0.00
R6414:Espl1 UTSW 15 102,223,995 (GRCm39) missense probably damaging 0.96
R6484:Espl1 UTSW 15 102,231,935 (GRCm39) missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102,207,660 (GRCm39) missense probably benign
R6928:Espl1 UTSW 15 102,207,342 (GRCm39) missense probably benign 0.28
R6995:Espl1 UTSW 15 102,212,535 (GRCm39) missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102,225,328 (GRCm39) critical splice donor site probably null
R7062:Espl1 UTSW 15 102,207,331 (GRCm39) missense probably benign 0.00
R7135:Espl1 UTSW 15 102,227,959 (GRCm39) nonsense probably null
R7154:Espl1 UTSW 15 102,232,484 (GRCm39) missense probably damaging 1.00
R7164:Espl1 UTSW 15 102,221,638 (GRCm39) missense probably damaging 1.00
R7522:Espl1 UTSW 15 102,213,486 (GRCm39) missense probably damaging 1.00
R7848:Espl1 UTSW 15 102,224,961 (GRCm39) missense probably damaging 1.00
R7894:Espl1 UTSW 15 102,212,460 (GRCm39) missense probably damaging 1.00
R8275:Espl1 UTSW 15 102,211,188 (GRCm39) splice site probably benign
R8752:Espl1 UTSW 15 102,214,759 (GRCm39) missense probably damaging 1.00
R9160:Espl1 UTSW 15 102,206,953 (GRCm39) missense probably damaging 1.00
R9310:Espl1 UTSW 15 102,205,285 (GRCm39) critical splice donor site probably null
R9385:Espl1 UTSW 15 102,207,185 (GRCm39) missense probably damaging 0.99
R9532:Espl1 UTSW 15 102,228,260 (GRCm39) nonsense probably null
R9563:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9565:Espl1 UTSW 15 102,228,233 (GRCm39) missense possibly damaging 0.82
R9723:Espl1 UTSW 15 102,229,170 (GRCm39) missense probably benign 0.43
X0062:Espl1 UTSW 15 102,206,832 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGCTGCTTGGAATGTTAG -3'
(R):5'- AGACAGACATCAATGTGGAGCC -3'

Sequencing Primer
(F):5'- GGAAAGAGCTCTGTGTTCAATTAG -3'
(R):5'- TGGAGCCACAGTCGGATTCAC -3'
Posted On 2014-08-25