Mutagenetix > Incidental Mutation

Incidental Mutation 'R2009:Vmn2r107'

219397

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r107

Ensembl Gene

ENSMUSG00000056910

Gene Name

vomeronasal 2, receptor 107

Synonyms

V2r6

MMRRC Submission

040018-MU

Accession Numbers

Genbank: NM_001104569; MGI: 1316664

Essential gene?

Probably non essential (E-score: 0.085) question?

Stock #

R2009 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20345425-20375772 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 20375467 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 761 (M761L)

Ref Sequence

ENSEMBL: ENSMUSP00000048706 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042090]

AlphaFold

E9PZJ7

Predicted Effect

probably benign
Transcript: ENSMUST00000042090
AA Change: M761L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000048706
Gene: ENSMUSG00000056910
AA Change: M761L

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	83	466	3.6e-40	PFAM
Pfam:NCD3G	509	562	5.1e-21	PFAM
Pfam:7tm_3	593	830	8e-51	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.1%

Validation Efficiency

100% (47/47)

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts15	T	A	9: 30,922,137	D34V	probably benign	Het
Adgrf1	A	T	17: 43,321,221	R884*	probably null	Het
Adgrg7	T	C	16: 56,761,873	T301A	probably benign	Het
Als2cr11b	A	T	1: 59,003,232		noncoding transcript	Het
Arhgef17	A	G	7: 100,881,781	I1366T	probably damaging	Het
BC037034	C	A	5: 138,260,929	C434F	probably damaging	Het
C1s2	A	T	6: 124,635,089	L112H	probably damaging	Het
Cfap74	G	A	4: 155,420,267	R103H	possibly damaging	Het
Col7a1	A	T	9: 108,968,875		probably null	Het
Dmp1	A	G	5: 104,212,840	S461G	probably damaging	Het
Eif4g2	A	T	7: 111,074,198	D753E	probably benign	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Etv4	T	C	11: 101,774,237	D130G	probably damaging	Het
Gabbr2	A	T	4: 46,734,119	I533N	probably damaging	Het
Gne	T	C	4: 44,055,273	E234G	probably benign	Het
Itga6	C	A	2: 71,816,681	N78K	probably benign	Het
Lap3	C	T	5: 45,493,557	T33M	probably benign	Het
Limd1	A	G	9: 123,479,499	S88G	probably benign	Het
Lrp1	G	T	10: 127,544,516	T3922K	probably damaging	Het
Map4k3	A	G	17: 80,664,088		probably benign	Het
Mib1	T	C	18: 10,812,118	L263S	probably damaging	Het
Ncor1	T	C	11: 62,325,601	S1474G	probably benign	Het
Nkapl	A	C	13: 21,467,437	S335R	probably damaging	Het
Nrg3	A	G	14: 38,370,814	S605P	probably damaging	Het
Olfr248	G	T	1: 174,391,429	R120L	possibly damaging	Het
Olfr549	A	G	7: 102,554,944	Y220C	probably damaging	Het
Patj	G	A	4: 98,456,169	D577N	probably damaging	Het
Pfpl	A	C	19: 12,429,955	K523N	possibly damaging	Het
Pik3c2a	A	C	7: 116,364,503	L924R	probably damaging	Het
Pkd2l1	C	A	19: 44,155,964	R278L	probably benign	Het
Prss2	A	T	6: 41,523,976	I108F	probably damaging	Het
Rnase2b	A	G	14: 51,162,890	T143A	possibly damaging	Het
Sgk1	C	T	10: 21,996,601	R171W	probably damaging	Het
Sphk2	A	T	7: 45,711,013	H522Q	probably damaging	Het
Szt2	A	G	4: 118,378,064		probably null	Het
Tmem88	C	A	11: 69,397,776	A106S	probably damaging	Het
Trim39	A	G	17: 36,263,754	L252S	possibly damaging	Het
Trim60	T	A	8: 65,001,323	E91D	probably damaging	Het
Trpm5	A	G	7: 143,087,738	I145T	possibly damaging	Het
Wdr4	G	A	17: 31,500,610		probably benign	Het
Wfs1	A	T	5: 36,968,309	S413T	probably damaging	Het
Wnt2	A	T	6: 18,030,209	W27R	probably damaging	Het
Zc3h3	A	T	15: 75,779,309	H687Q	probably damaging	Het
Zfp750	G	A	11: 121,513,125	P308L	possibly damaging	Het

Other mutations in Vmn2r107

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01402:Vmn2r107	APN	17	20375747	missense	probably damaging	0.98
IGL01768:Vmn2r107	APN	17	20345606	missense	probably benign	0.32
IGL02086:Vmn2r107	APN	17	20357800	missense	probably benign	0.00
IGL02136:Vmn2r107	APN	17	20374906	missense	probably benign	0.02
IGL02266:Vmn2r107	APN	17	20356777	missense	probably damaging	1.00
IGL02285:Vmn2r107	APN	17	20375561	missense	probably damaging	1.00
IGL02724:Vmn2r107	APN	17	20356744	missense	possibly damaging	0.49
IGL02998:Vmn2r107	APN	17	20357755	missense	probably damaging	0.99
IGL03089:Vmn2r107	APN	17	20375712	missense	probably benign	0.05
IGL03284:Vmn2r107	APN	17	20356911	missense	probably benign	0.07
IGL03307:Vmn2r107	APN	17	20356776	missense	probably benign	0.09
IGL03399:Vmn2r107	APN	17	20357958	splice site	probably benign
3-1:Vmn2r107	UTSW	17	20345504	missense	probably benign
BB006:Vmn2r107	UTSW	17	20345444	missense	probably null	0.96
BB016:Vmn2r107	UTSW	17	20345444	missense	probably null	0.96
R0285:Vmn2r107	UTSW	17	20345611	missense	probably benign	0.00
R0455:Vmn2r107	UTSW	17	20374823	splice site	probably benign
R0497:Vmn2r107	UTSW	17	20375132	missense	probably damaging	1.00
R0506:Vmn2r107	UTSW	17	20357759	missense	probably benign
R0621:Vmn2r107	UTSW	17	20374990	missense	probably benign	0.01
R0667:Vmn2r107	UTSW	17	20355654	missense	possibly damaging	0.91
R1118:Vmn2r107	UTSW	17	20356598	missense	probably benign	0.03
R1204:Vmn2r107	UTSW	17	20357769	missense	probably benign
R1237:Vmn2r107	UTSW	17	20356685	nonsense	probably null
R1485:Vmn2r107	UTSW	17	20374847	missense	possibly damaging	0.95
R1783:Vmn2r107	UTSW	17	20356513	missense	possibly damaging	0.51
R1873:Vmn2r107	UTSW	17	20345578	missense	probably benign	0.10
R1974:Vmn2r107	UTSW	17	20355617	splice site	probably null
R2029:Vmn2r107	UTSW	17	20375287	missense	probably benign	0.01
R2164:Vmn2r107	UTSW	17	20375642	missense	probably damaging	1.00
R2269:Vmn2r107	UTSW	17	20375555	missense	possibly damaging	0.58
R3087:Vmn2r107	UTSW	17	20360345	missense	probably benign	0.03
R3740:Vmn2r107	UTSW	17	20374889	missense	probably benign	0.00
R3961:Vmn2r107	UTSW	17	20375455	missense	probably damaging	1.00
R4031:Vmn2r107	UTSW	17	20375221	missense	probably benign	0.00
R4270:Vmn2r107	UTSW	17	20355779	missense	probably benign
R4963:Vmn2r107	UTSW	17	20375141	missense	probably damaging	1.00
R5121:Vmn2r107	UTSW	17	20355753	missense	probably benign	0.01
R5640:Vmn2r107	UTSW	17	20375164	missense	probably damaging	1.00
R6007:Vmn2r107	UTSW	17	20375054	missense	probably benign	0.19
R6238:Vmn2r107	UTSW	17	20345587	missense	probably benign	0.43
R6298:Vmn2r107	UTSW	17	20355782	missense	probably benign	0.00
R6467:Vmn2r107	UTSW	17	20375677	missense	probably damaging	0.99
R6726:Vmn2r107	UTSW	17	20375375	missense	probably damaging	0.96
R6782:Vmn2r107	UTSW	17	20356879	missense	probably damaging	1.00
R7299:Vmn2r107	UTSW	17	20345616	missense	probably benign	0.01
R7301:Vmn2r107	UTSW	17	20345616	missense	probably benign	0.01
R7375:Vmn2r107	UTSW	17	20355876	missense	probably benign
R7448:Vmn2r107	UTSW	17	20375732	missense	probably benign	0.00
R7495:Vmn2r107	UTSW	17	20375009	missense	possibly damaging	0.71
R7589:Vmn2r107	UTSW	17	20375372	missense	probably benign	0.05
R7594:Vmn2r107	UTSW	17	20360373	missense	probably benign	0.03
R7678:Vmn2r107	UTSW	17	20356639	missense	probably benign	0.01
R7929:Vmn2r107	UTSW	17	20345444	missense	probably null	0.96
R7974:Vmn2r107	UTSW	17	20357008	missense	probably benign	0.00
R8040:Vmn2r107	UTSW	17	20375546	missense	probably damaging	1.00
R8263:Vmn2r107	UTSW	17	20360352	missense	probably damaging	1.00
R8426:Vmn2r107	UTSW	17	20356977	missense	possibly damaging	0.91
R9175:Vmn2r107	UTSW	17	20356789	missense	possibly damaging	0.79
R9537:Vmn2r107	UTSW	17	20374887	missense	probably benign	0.00
R9642:Vmn2r107	UTSW	17	20360399	missense	probably damaging	1.00
R9711:Vmn2r107	UTSW	17	20357000	missense	probably damaging	1.00
X0022:Vmn2r107	UTSW	17	20356968	missense	possibly damaging	0.85

Predicted Primers

PCR Primer
(F):5'- TTTTCCAGGGAGAATGGTAAGG -3'
(R):5'- TGTGCTGGAAGCCAAGATAG -3'

Sequencing Primer
(F):5'- TGGCTAATGATATCAAGGGGTCC -3'
(R):5'- AGAGAATACTTCCATAGCTACCATG -3'

Posted On

2014-08-25