Incidental Mutation 'R0136:Slc26a5'
ID21940
Institutional Source Beutler Lab
Gene Symbol Slc26a5
Ensembl Gene ENSMUSG00000029015
Gene Namesolute carrier family 26, member 5
SynonymsPres, prestin
MMRRC Submission 038421-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0136 (G1)
Quality Score225
Status Validated (trace)
Chromosome5
Chromosomal Location21810655-21865604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21834347 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 216 (N216S)
Ref Sequence ENSEMBL: ENSMUSP00000110830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030878] [ENSMUST00000115176] [ENSMUST00000127975] [ENSMUST00000142888]
Predicted Effect probably damaging
Transcript: ENSMUST00000030878
AA Change: N253S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030878
Gene: ENSMUSG00000029015
AA Change: N253S

DomainStartEndE-ValueType
Pfam:Sulfate_transp 80 475 3.3e-109 PFAM
transmembrane domain 476 498 N/A INTRINSIC
Pfam:STAS 526 709 3.3e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115176
AA Change: N216S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110830
Gene: ENSMUSG00000029015
AA Change: N216S

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 65 106 5.2e-9 PFAM
Pfam:Sulfate_transp 156 434 1.6e-65 PFAM
transmembrane domain 439 461 N/A INTRINSIC
Pfam:STAS 489 672 1.5e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000127975
AA Change: N253S

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118029
Gene: ENSMUSG00000029015
AA Change: N253S

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 65 148 4.3e-33 PFAM
Pfam:Sulfate_transp 193 440 8.9e-56 PFAM
transmembrane domain 447 469 N/A INTRINSIC
Pfam:STAS 494 677 4.1e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000142888
AA Change: N253S

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118263
Gene: ENSMUSG00000029015
AA Change: N253S

DomainStartEndE-ValueType
Pfam:Sulfate_tra_GLY 65 148 2.1e-33 PFAM
Pfam:Sulfate_transp 193 441 9.6e-49 PFAM
Meta Mutation Damage Score 0.1185 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 89% (56/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC26A/SulP transporter family. The protein functions as a molecular motor in motile outer hair cells (OHCs) of the cochlea, inducing changes in cell length that act to amplify sound levels. The transmembrane protein is an incomplete anion transporter, and does not allow anions to cross the cell membrane but instead undergoes a conformational change in response to changes in intracellular Cl- levels that results in a change in cell length. The protein functions at microsecond rates, which is several orders of magnitude faster than conventional molecular motor proteins. Mutations in this gene are potential candidates for causing neurosensory deafness. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Nov 2009]
PHENOTYPE: Cochlear sensitivity is decreased in mutant due to a loss of outer hair cell electromotility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap4b1 T C 3: 103,809,946 M1T probably null Het
Arg2 T C 12: 79,150,006 L167P probably damaging Het
Atxn1 A G 13: 45,567,169 S417P probably damaging Het
Baz2b A G 2: 59,901,954 V1949A probably benign Het
Bcl3 A G 7: 19,809,569 V324A probably damaging Het
Btbd10 A T 7: 113,329,878 S230T possibly damaging Het
Camta1 A G 4: 151,078,969 S1479P probably damaging Het
Cd69 C T 6: 129,270,062 S64N probably benign Het
Col5a1 T C 2: 28,024,831 L153P probably damaging Het
Crat C A 2: 30,407,030 V304L probably benign Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Fau T C 19: 6,059,180 V86A possibly damaging Het
Garem1 T G 18: 21,129,991 S589R probably damaging Het
Gbp3 T G 3: 142,564,101 probably null Het
Gin1 T A 1: 97,783,016 S141R possibly damaging Het
Gtf2h1 A T 7: 46,815,416 Q419L possibly damaging Het
Hipk3 A G 2: 104,439,293 I517T probably benign Het
Hivep2 T C 10: 14,131,878 S1407P probably benign Het
Hnrnpk G T 13: 58,395,177 D211E probably benign Het
Hnrnpul2 T C 19: 8,826,801 L588P probably damaging Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Itgb1 T G 8: 128,722,854 Y585D possibly damaging Het
Kmt2d C T 15: 98,854,278 probably benign Het
Map7d1 A T 4: 126,236,631 probably null Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Med13l A G 5: 118,724,050 T353A probably benign Het
Mgat4b T C 11: 50,231,081 V143A possibly damaging Het
Mlxip T A 5: 123,442,306 W211R probably damaging Het
Morc2a T G 11: 3,685,907 probably null Het
Muc4 A T 16: 32,750,195 probably benign Het
Ndufa10 A T 1: 92,463,128 Y233* probably null Het
Nek8 C T 11: 78,171,207 S237N probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nfatc2ip A G 7: 126,391,335 S165P probably benign Het
Nsd2 A G 5: 33,855,536 K404E possibly damaging Het
Nsd3 G T 8: 25,659,854 E352* probably null Het
Nudt9 A G 5: 104,047,106 T23A probably benign Het
Olfr394 T C 11: 73,887,785 M196V probably benign Het
Olfr394 C T 11: 73,887,830 V181I probably benign Het
Olfr983 A G 9: 40,092,019 *312Q probably null Het
Patj C A 4: 98,667,648 Q297K probably damaging Het
Pelo A T 13: 115,088,903 C40* probably null Het
Pnpla3 G A 15: 84,174,478 probably null Het
Pramel1 C A 4: 143,397,446 N230K probably damaging Het
Psg20 A C 7: 18,682,507 L228R probably damaging Het
Rsph10b T C 5: 143,959,821 F44L probably benign Het
Sept2 G A 1: 93,507,050 G358R possibly damaging Het
Slamf7 G A 1: 171,648,931 probably benign Het
Slc12a8 A G 16: 33,608,213 D297G probably damaging Het
Slc17a5 G A 9: 78,578,674 A43V probably damaging Het
Slc22a1 A T 17: 12,662,596 F335L probably benign Het
Snrnp27 T C 6: 86,676,205 S144G probably benign Het
Spata20 T A 11: 94,480,609 D643V probably damaging Het
Spata24 T C 18: 35,660,462 K99R probably damaging Het
Taar5 A G 10: 23,971,709 Y335C probably damaging Het
Tpr A G 1: 150,430,595 H1540R probably benign Het
Vmn1r27 A G 6: 58,215,719 F100S possibly damaging Het
Vmn2r37 A T 7: 9,217,783 Y360* probably null Het
Ybx1 C A 4: 119,282,354 R36L possibly damaging Het
Zfp369 A G 13: 65,297,202 K720E probably benign Het
Zfp599 A G 9: 22,249,742 S376P probably benign Het
Zic2 A G 14: 122,476,541 E289G probably damaging Het
Zzef1 T C 11: 72,821,851 V199A probably benign Het
Other mutations in Slc26a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Slc26a5 APN 5 21815736 missense probably damaging 1.00
IGL02486:Slc26a5 APN 5 21846325 missense probably damaging 1.00
IGL02639:Slc26a5 APN 5 21819767 missense probably damaging 1.00
IGL02810:Slc26a5 APN 5 21813383 splice site probably benign
R0002:Slc26a5 UTSW 5 21814983 missense probably damaging 1.00
R0002:Slc26a5 UTSW 5 21814983 missense probably damaging 1.00
R0089:Slc26a5 UTSW 5 21811344 splice site probably null
R0212:Slc26a5 UTSW 5 21823549 nonsense probably null
R0522:Slc26a5 UTSW 5 21846345 missense probably damaging 0.96
R0557:Slc26a5 UTSW 5 21819764 missense probably damaging 1.00
R0711:Slc26a5 UTSW 5 21847232 missense probably damaging 1.00
R0959:Slc26a5 UTSW 5 21816961 missense probably benign 0.01
R1214:Slc26a5 UTSW 5 21814983 missense probably damaging 1.00
R1471:Slc26a5 UTSW 5 21816964 missense probably benign 0.12
R1647:Slc26a5 UTSW 5 21813976 nonsense probably null
R1648:Slc26a5 UTSW 5 21813976 nonsense probably null
R1861:Slc26a5 UTSW 5 21816958 missense possibly damaging 0.93
R1875:Slc26a5 UTSW 5 21815727 missense probably benign 0.03
R2106:Slc26a5 UTSW 5 21823544 missense probably damaging 1.00
R2169:Slc26a5 UTSW 5 21813865 missense probably damaging 1.00
R2219:Slc26a5 UTSW 5 21823478 missense probably damaging 1.00
R2276:Slc26a5 UTSW 5 21823547 missense probably benign 0.39
R2281:Slc26a5 UTSW 5 21831510 missense possibly damaging 0.94
R2325:Slc26a5 UTSW 5 21819694 missense probably damaging 1.00
R4031:Slc26a5 UTSW 5 21847191 missense probably damaging 1.00
R4793:Slc26a5 UTSW 5 21837994 missense probably damaging 1.00
R4941:Slc26a5 UTSW 5 21820386 missense probably damaging 1.00
R5122:Slc26a5 UTSW 5 21847196 missense probably damaging 1.00
R5274:Slc26a5 UTSW 5 21813901 missense possibly damaging 0.74
R5312:Slc26a5 UTSW 5 21847260 missense probably damaging 0.99
R5628:Slc26a5 UTSW 5 21816976 missense probably benign 0.20
R5806:Slc26a5 UTSW 5 21823563 missense probably damaging 1.00
R6227:Slc26a5 UTSW 5 21821097 missense probably damaging 1.00
R6525:Slc26a5 UTSW 5 21820350 missense possibly damaging 0.77
R6609:Slc26a5 UTSW 5 21819719 missense possibly damaging 0.93
R6885:Slc26a5 UTSW 5 21834344 missense probably damaging 1.00
R6974:Slc26a5 UTSW 5 21840572 missense probably damaging 1.00
R7001:Slc26a5 UTSW 5 21811336 missense probably damaging 1.00
R7027:Slc26a5 UTSW 5 21816974 missense possibly damaging 0.60
R7174:Slc26a5 UTSW 5 21813894 missense probably damaging 1.00
R7184:Slc26a5 UTSW 5 21837246 nonsense probably null
R7650:Slc26a5 UTSW 5 21834330 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGGGCTGAACAGGCCACCAC -3'
(R):5'- ACTTTTAAGTTGAGGCTCATCGGAATCC -3'

Sequencing Primer
(F):5'- ACCTTGTACATACTTACAGCAAAG -3'
(R):5'- acacacacccaggcatac -3'
Posted On2013-04-12