Incidental Mutation 'R2009:Trim39'
ID219401
Institutional Source Beutler Lab
Gene Symbol Trim39
Ensembl Gene ENSMUSG00000045409
Gene Nametripartite motif-containing 39
SynonymsRnf23, RING-B box-coiled-coil-B30.2, RBCC-B30.2, tfp, 1100001D15Rik, E130103K13Rik
MMRRC Submission 040018-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2009 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location36258873-36272247 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36263754 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 252 (L252S)
Ref Sequence ENSEMBL: ENSMUSP00000133298 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042717] [ENSMUST00000113706] [ENSMUST00000173369] [ENSMUST00000173665]
Predicted Effect possibly damaging
Transcript: ENSMUST00000042717
AA Change: L252S

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000039790
Gene: ENSMUSG00000045409
AA Change: L252S

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
RING 29 69 1.9e-10 SMART
BBOX 102 143 3.21e-8 SMART
coiled coil region 184 240 N/A INTRINSIC
PRY 306 359 2.3e-27 SMART
SPRY 360 485 1.95e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113704
Predicted Effect possibly damaging
Transcript: ENSMUST00000113706
AA Change: L252S

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109336
Gene: ENSMUSG00000045409
AA Change: L252S

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
RING 29 69 1.9e-10 SMART
BBOX 102 143 3.21e-8 SMART
coiled coil region 184 240 N/A INTRINSIC
PRY 306 359 2.3e-27 SMART
SPRY 360 485 1.95e-31 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172832
Predicted Effect possibly damaging
Transcript: ENSMUST00000173369
AA Change: L252S

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133298
Gene: ENSMUSG00000045409
AA Change: L252S

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
RING 29 69 1.9e-10 SMART
BBOX 102 143 3.21e-8 SMART
coiled coil region 184 240 N/A INTRINSIC
PRY 314 367 1.23e-27 SMART
SPRY 368 493 1.95e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173665
SMART Domains Protein: ENSMUSP00000133529
Gene: ENSMUSG00000045409

DomainStartEndE-ValueType
BBOX 1 40 5.81e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174197
Meta Mutation Damage Score 0.0782 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The function of this protein has not been identified. This gene lies within the major histocompatibility complex class I region on chromosome 6. Alternate splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 T A 9: 30,922,137 D34V probably benign Het
Adgrf1 A T 17: 43,321,221 R884* probably null Het
Adgrg7 T C 16: 56,761,873 T301A probably benign Het
Als2cr11b A T 1: 59,003,232 noncoding transcript Het
Arhgef17 A G 7: 100,881,781 I1366T probably damaging Het
BC037034 C A 5: 138,260,929 C434F probably damaging Het
C1s2 A T 6: 124,635,089 L112H probably damaging Het
Cfap74 G A 4: 155,420,267 R103H possibly damaging Het
Col7a1 A T 9: 108,968,875 probably null Het
Dmp1 A G 5: 104,212,840 S461G probably damaging Het
Eif4g2 A T 7: 111,074,198 D753E probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etv4 T C 11: 101,774,237 D130G probably damaging Het
Gabbr2 A T 4: 46,734,119 I533N probably damaging Het
Gne T C 4: 44,055,273 E234G probably benign Het
Itga6 C A 2: 71,816,681 N78K probably benign Het
Lap3 C T 5: 45,493,557 T33M probably benign Het
Limd1 A G 9: 123,479,499 S88G probably benign Het
Lrp1 G T 10: 127,544,516 T3922K probably damaging Het
Map4k3 A G 17: 80,664,088 probably benign Het
Mib1 T C 18: 10,812,118 L263S probably damaging Het
Ncor1 T C 11: 62,325,601 S1474G probably benign Het
Nkapl A C 13: 21,467,437 S335R probably damaging Het
Nrg3 A G 14: 38,370,814 S605P probably damaging Het
Olfr248 G T 1: 174,391,429 R120L possibly damaging Het
Olfr549 A G 7: 102,554,944 Y220C probably damaging Het
Patj G A 4: 98,456,169 D577N probably damaging Het
Pfpl A C 19: 12,429,955 K523N possibly damaging Het
Pik3c2a A C 7: 116,364,503 L924R probably damaging Het
Pkd2l1 C A 19: 44,155,964 R278L probably benign Het
Prss2 A T 6: 41,523,976 I108F probably damaging Het
Rnase2b A G 14: 51,162,890 T143A possibly damaging Het
Sgk1 C T 10: 21,996,601 R171W probably damaging Het
Sphk2 A T 7: 45,711,013 H522Q probably damaging Het
Szt2 A G 4: 118,378,064 probably null Het
Tmem88 C A 11: 69,397,776 A106S probably damaging Het
Trim60 T A 8: 65,001,323 E91D probably damaging Het
Trpm5 A G 7: 143,087,738 I145T possibly damaging Het
Vmn2r107 A T 17: 20,375,467 M761L probably benign Het
Wdr4 G A 17: 31,500,610 probably benign Het
Wfs1 A T 5: 36,968,309 S413T probably damaging Het
Wnt2 A T 6: 18,030,209 W27R probably damaging Het
Zc3h3 A T 15: 75,779,309 H687Q probably damaging Het
Zfp750 G A 11: 121,513,125 P308L possibly damaging Het
Other mutations in Trim39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Trim39 APN 17 36263963 splice site probably benign
IGL01462:Trim39 APN 17 36263725 splice site probably benign
IGL02243:Trim39 APN 17 36260384 missense probably damaging 1.00
IGL03390:Trim39 APN 17 36260571 missense probably damaging 0.99
barba UTSW 17 36268854 missense probably damaging 1.00
rossa UTSW 17 36260915 missense probably damaging 1.00
PIT4305001:Trim39 UTSW 17 36268970 missense possibly damaging 0.93
R0458:Trim39 UTSW 17 36261512 missense probably damaging 1.00
R0569:Trim39 UTSW 17 36263731 missense probably benign 0.36
R1565:Trim39 UTSW 17 36268854 missense probably damaging 1.00
R1769:Trim39 UTSW 17 36263940 missense probably damaging 1.00
R1969:Trim39 UTSW 17 36268753 missense probably benign 0.01
R2568:Trim39 UTSW 17 36269164 unclassified probably benign
R5206:Trim39 UTSW 17 36260490 missense probably damaging 1.00
R5443:Trim39 UTSW 17 36260753 missense probably damaging 1.00
R6481:Trim39 UTSW 17 36268662 missense probably benign 0.03
R7132:Trim39 UTSW 17 36260655 missense probably benign 0.25
R7563:Trim39 UTSW 17 36260915 missense probably damaging 1.00
R7739:Trim39 UTSW 17 36260504 missense possibly damaging 0.50
R8433:Trim39 UTSW 17 36260705 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- ATAGAAACCTGAGCTGCCCC -3'
(R):5'- TCTCAGAGACTGGTGGAGAG -3'

Sequencing Primer
(F):5'- GCTGCCCCGCTCTAGAAAAATG -3'
(R):5'- CGCCGGCAGCAGATCTTAAAG -3'
Posted On2014-08-25