Incidental Mutation 'R1969:Hey1'
ID219402
Institutional Source Beutler Lab
Gene Symbol Hey1
Ensembl Gene ENSMUSG00000040289
Gene Namehairy/enhancer-of-split related with YRPW motif 1
SynonymsHRT1, CHF2, hesr-1, bHLHb31, Herp2, Hesr1
MMRRC Submission 039982-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1969 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location8663359-8667256 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8666819 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 18 (T18A)
Ref Sequence ENSEMBL: ENSMUSP00000038014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042412]
Predicted Effect probably benign
Transcript: ENSMUST00000042412
AA Change: T18A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000038014
Gene: ENSMUSG00000040289
AA Change: T18A

DomainStartEndE-ValueType
HLH 55 110 2.3e-14 SMART
ORANGE 120 167 2.8e-14 SMART
low complexity region 186 197 N/A INTRINSIC
low complexity region 232 244 N/A INTRINSIC
low complexity region 246 277 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192550
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194299
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein belonging to the hairy and enhancer of split-related (HESR) family of basic helix-loop-helix (bHLH)-type transcriptional repressors. Expression of this gene is induced by the Notch and c-Jun signal transduction pathways. Two similar and redundant genes in mouse are required for embryonic cardiovascular development, and are also implicated in neurogenesis and somitogenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are healthy and fertile with no major developmental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T C 19: 21,598,245 probably benign Het
1700014D04Rik T C 13: 59,742,785 D407G probably damaging Het
9930021J03Rik C T 19: 29,716,675 S1873N possibly damaging Het
Apoh G A 11: 108,407,462 R196Q probably benign Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
B4galnt4 T C 7: 141,064,848 F194L probably benign Het
BC034090 A T 1: 155,225,226 L431M possibly damaging Het
Bdh2 G T 3: 135,288,279 A31S probably damaging Het
Cacna1s T C 1: 136,119,095 S1821P probably benign Het
Caskin1 A T 17: 24,506,850 Q1370L possibly damaging Het
Ccdc83 T A 7: 90,244,154 S132C probably damaging Het
Cdk15 A T 1: 59,330,951 H384L probably damaging Het
Col24a1 T C 3: 145,314,930 I354T probably benign Het
Coro7 T C 16: 4,633,756 I451V probably benign Het
Ctnna2 T C 6: 77,758,500 E65G probably damaging Het
Ctsll3 A T 13: 60,800,348 W172R probably benign Het
D230025D16Rik T A 8: 105,246,500 D247E possibly damaging Het
D630045J12Rik T C 6: 38,168,143 D1316G probably damaging Het
Ddx19b C T 8: 111,008,258 A493T probably benign Het
Ddx4 C T 13: 112,600,013 V608I probably damaging Het
Ddx4 T A 13: 112,620,742 H348L probably damaging Het
Dnah17 G C 11: 118,104,535 Q996E probably benign Het
Dnah9 G C 11: 65,848,371 N4180K probably damaging Het
Dok7 A G 5: 35,077,266 probably null Het
Dpf3 T A 12: 83,325,035 probably null Het
Elfn1 G C 5: 139,972,849 R536P probably damaging Het
Eml6 A G 11: 29,833,075 V602A probably benign Het
Enpp2 T C 15: 54,882,982 D296G probably damaging Het
Evi5 A T 5: 107,748,364 F738I probably benign Het
Eya2 T C 2: 165,716,119 S212P probably benign Het
Fam83a T C 15: 57,986,102 L14P probably damaging Het
Fanca A T 8: 123,288,064 M735K probably benign Het
Fancm T A 12: 65,101,692 S694T probably benign Het
Fibcd1 G A 2: 31,816,661 T386I probably damaging Het
Foxd4 A G 19: 24,899,814 S341P probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Fryl A T 5: 73,098,266 S807R probably benign Het
Fscb T C 12: 64,473,234 E486G unknown Het
Galnt17 A G 5: 131,150,944 S122P probably benign Het
Ghitm A G 14: 37,131,629 F85L probably benign Het
Ghrh C A 2: 157,333,466 V32L probably benign Het
Gli2 C T 1: 118,837,700 R907H probably benign Het
Gm11639 A G 11: 104,746,264 I988M probably damaging Het
Gm28042 A G 2: 120,041,615 *1015W probably null Het
Gpr179 T C 11: 97,337,958 T1124A probably benign Het
Grid2 C A 6: 63,908,918 C99* probably null Het
Grin1 A T 2: 25,297,915 M523K probably benign Het
Gucy2g T C 19: 55,222,896 Y634C possibly damaging Het
Gucy2g T G 19: 55,233,053 T339P probably benign Het
Haus6 A T 4: 86,604,246 L116H probably damaging Het
Hipk3 T C 2: 104,433,841 N792D probably damaging Het
Il19 A T 1: 130,939,156 L29Q probably damaging Het
Il21r A G 7: 125,628,972 Q205R probably damaging Het
Kcnip2 T C 19: 45,793,683 D169G probably null Het
Kctd18 T C 1: 57,967,620 I24V probably benign Het
Lcp1 T C 14: 75,200,506 S119P probably damaging Het
Lig3 G C 11: 82,795,718 D642H probably benign Het
Lrba A G 3: 86,608,389 K2166E probably damaging Het
Lrrn2 T C 1: 132,939,234 V679A probably benign Het
Lyst G A 13: 13,730,344 R3202H probably damaging Het
Micall2 A G 5: 139,736,130 C11R probably damaging Het
Morc2b T G 17: 33,137,091 Q569P probably benign Het
Mtrf1 A G 14: 79,401,671 E81G probably damaging Het
Myh2 G T 11: 67,189,178 S1099I possibly damaging Het
Nap1l1 T A 10: 111,491,053 D158E probably benign Het
Nckap5l T A 15: 99,422,818 T1285S probably damaging Het
Nsrp1 A T 11: 77,045,786 M528K probably damaging Het
Numa1 C T 7: 102,009,322 A1605V probably damaging Het
Nutm2 T C 13: 50,473,842 L453P probably damaging Het
Ofd1 T C X: 166,427,214 Y205C probably benign Het
Olfr1233 T A 2: 89,340,296 N2I probably damaging Het
Olfr135 A G 17: 38,208,464 Y73C probably damaging Het
Olfr19 T A 16: 16,673,583 M133L probably benign Het
Olfr552 A T 7: 102,604,570 D72V probably damaging Het
Olfr693 T A 7: 106,677,670 N272I probably damaging Het
Patl1 T C 19: 11,921,418 L159P probably benign Het
Paxip1 G A 5: 27,744,136 T1045I probably damaging Het
Pik3ca A G 3: 32,451,754 probably null Het
Pkhd1 T A 1: 20,381,523 I2183F probably damaging Het
Plec C T 15: 76,189,172 R319H probably damaging Het
Pnkd G A 1: 74,351,849 G334D probably damaging Het
Prss50 A G 9: 110,862,381 Y251C probably damaging Het
Rab11b A T 17: 33,760,235 Y10N probably damaging Het
Rfc1 G A 5: 65,319,524 R4W probably damaging Het
Rgs19 A T 2: 181,689,483 F119Y probably damaging Het
Safb A G 17: 56,605,821 H883R probably benign Het
Serpine1 G A 5: 137,067,747 Q227* probably null Het
Slc25a13 A G 6: 6,096,668 probably null Het
Slc6a18 T A 13: 73,664,189 T502S possibly damaging Het
Sox4 T C 13: 28,952,648 D125G probably damaging Het
Stag3 C T 5: 138,300,138 T731I probably damaging Het
Thada G T 17: 84,310,042 P1349T probably damaging Het
Tmem245 C A 4: 56,937,964 V195F probably benign Het
Tnxb A G 17: 34,679,081 H901R probably benign Het
Trim39 A T 17: 36,268,753 D103E probably benign Het
Ttn A T 2: 76,731,960 V28847E probably damaging Het
Tubb1 A T 2: 174,455,691 D31V possibly damaging Het
Ush1g A G 11: 115,318,454 S305P probably damaging Het
Vmn1r191 A T 13: 22,178,782 N267K possibly damaging Het
Vmn1r59 A T 7: 5,454,039 Y241N probably damaging Het
Vmn2r49 T C 7: 9,986,308 N419D probably damaging Het
Vps35 T C 8: 85,278,994 D326G possibly damaging Het
Xdh A G 17: 73,892,751 S1187P possibly damaging Het
Xpc A C 6: 91,501,025 probably null Het
Zfp273 T C 13: 67,825,163 Y104H probably damaging Het
Other mutations in Hey1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02116:Hey1 APN 3 8666580 splice site probably null
IGL02486:Hey1 APN 3 8666519 missense probably damaging 1.00
IGL03265:Hey1 APN 3 8664914 missense probably benign 0.07
R1615:Hey1 UTSW 3 8664838 missense possibly damaging 0.47
R1987:Hey1 UTSW 3 8664897 missense probably benign 0.16
R2419:Hey1 UTSW 3 8665943 critical splice donor site probably null
R3177:Hey1 UTSW 3 8664891 missense probably benign 0.10
R3277:Hey1 UTSW 3 8664891 missense probably benign 0.10
R3941:Hey1 UTSW 3 8664578 missense probably damaging 1.00
R4709:Hey1 UTSW 3 8665903 intron probably benign
R5977:Hey1 UTSW 3 8666358 splice site probably null
R5988:Hey1 UTSW 3 8666319 missense probably damaging 1.00
X0019:Hey1 UTSW 3 8664867 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GATGGGAAGCAATTGCCTTGAG -3'
(R):5'- TTAACCGGAGACTGAGCGTG -3'

Sequencing Primer
(F):5'- CACCAGATTTCTTTGGCAACTTGAG -3'
(R):5'- ACTGAGCGTGAGTGGGATC -3'
Posted On2014-08-25