Incidental Mutation 'R2009:Pfpl'
ID 219408
Institutional Source Beutler Lab
Gene Symbol Pfpl
Ensembl Gene ENSMUSG00000040065
Gene Name pore forming protein-like
Synonyms Epcs5, Epcs50
MMRRC Submission 040018-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.114) question?
Stock # R2009 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 12405290-12409474 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 12407319 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 523 (K523N)
Ref Sequence ENSEMBL: ENSMUSP00000126346 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168148]
AlphaFold Q5RKV8
Predicted Effect possibly damaging
Transcript: ENSMUST00000168148
AA Change: K523N

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000126346
Gene: ENSMUSG00000040065
AA Change: K523N

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
MACPF 144 343 6.26e-33 SMART
transmembrane domain 643 665 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (47/47)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts15 T A 9: 30,833,433 (GRCm39) D34V probably benign Het
Adgrf1 A T 17: 43,632,112 (GRCm39) R884* probably null Het
Adgrg7 T C 16: 56,582,236 (GRCm39) T301A probably benign Het
Arhgef17 A G 7: 100,530,988 (GRCm39) I1366T probably damaging Het
C1s2 A T 6: 124,612,048 (GRCm39) L112H probably damaging Het
C2cd6 A T 1: 59,042,391 (GRCm39) noncoding transcript Het
Cfap74 G A 4: 155,504,724 (GRCm39) R103H possibly damaging Het
Col7a1 A T 9: 108,797,943 (GRCm39) probably null Het
Dmp1 A G 5: 104,360,706 (GRCm39) S461G probably damaging Het
Eif4g2 A T 7: 110,673,405 (GRCm39) D753E probably benign Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Etv4 T C 11: 101,665,063 (GRCm39) D130G probably damaging Het
Gabbr2 A T 4: 46,734,119 (GRCm39) I533N probably damaging Het
Gne T C 4: 44,055,273 (GRCm39) E234G probably benign Het
Itga6 C A 2: 71,647,025 (GRCm39) N78K probably benign Het
Lap3 C T 5: 45,650,899 (GRCm39) T33M probably benign Het
Limd1 A G 9: 123,308,564 (GRCm39) S88G probably benign Het
Lrp1 G T 10: 127,380,385 (GRCm39) T3922K probably damaging Het
Map4k3 A G 17: 80,971,517 (GRCm39) probably benign Het
Mib1 T C 18: 10,812,118 (GRCm39) L263S probably damaging Het
Ncor1 T C 11: 62,216,427 (GRCm39) S1474G probably benign Het
Nkapl A C 13: 21,651,607 (GRCm39) S335R probably damaging Het
Nrg3 A G 14: 38,092,771 (GRCm39) S605P probably damaging Het
Or10x4 G T 1: 174,218,995 (GRCm39) R120L possibly damaging Het
Or52b3 A G 7: 102,204,151 (GRCm39) Y220C probably damaging Het
Patj G A 4: 98,344,406 (GRCm39) D577N probably damaging Het
Pik3c2a A C 7: 115,963,738 (GRCm39) L924R probably damaging Het
Pkd2l1 C A 19: 44,144,403 (GRCm39) R278L probably benign Het
Prss2 A T 6: 41,500,910 (GRCm39) I108F probably damaging Het
Rnase2b A G 14: 51,400,347 (GRCm39) T143A possibly damaging Het
Sgk1 C T 10: 21,872,500 (GRCm39) R171W probably damaging Het
Sphk2 A T 7: 45,360,437 (GRCm39) H522Q probably damaging Het
Szt2 A G 4: 118,235,261 (GRCm39) probably null Het
Tmem88 C A 11: 69,288,602 (GRCm39) A106S probably damaging Het
Trappc14 C A 5: 138,259,191 (GRCm39) C434F probably damaging Het
Trim39 A G 17: 36,574,646 (GRCm39) L252S possibly damaging Het
Trim60 T A 8: 65,453,975 (GRCm39) E91D probably damaging Het
Trpm5 A G 7: 142,641,475 (GRCm39) I145T possibly damaging Het
Vmn2r107 A T 17: 20,595,729 (GRCm39) M761L probably benign Het
Wdr4 G A 17: 31,719,584 (GRCm39) probably benign Het
Wfs1 A T 5: 37,125,653 (GRCm39) S413T probably damaging Het
Wnt2 A T 6: 18,030,208 (GRCm39) W27R probably damaging Het
Zc3h3 A T 15: 75,651,158 (GRCm39) H687Q probably damaging Het
Zfp750 G A 11: 121,403,951 (GRCm39) P308L possibly damaging Het
Other mutations in Pfpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Pfpl APN 19 12,407,009 (GRCm39) missense probably benign 0.00
IGL01298:Pfpl APN 19 12,406,037 (GRCm39) missense possibly damaging 0.68
IGL01310:Pfpl APN 19 12,405,974 (GRCm39) missense probably damaging 1.00
IGL02273:Pfpl APN 19 12,407,327 (GRCm39) missense possibly damaging 0.96
IGL02532:Pfpl APN 19 12,406,209 (GRCm39) missense probably damaging 1.00
IGL02611:Pfpl APN 19 12,407,647 (GRCm39) missense probably benign
IGL02642:Pfpl APN 19 12,407,107 (GRCm39) missense probably damaging 1.00
IGL02715:Pfpl APN 19 12,407,145 (GRCm39) nonsense probably null
IGL03087:Pfpl APN 19 12,406,241 (GRCm39) missense probably benign 0.06
IGL03223:Pfpl APN 19 12,407,438 (GRCm39) missense probably damaging 1.00
IGL03253:Pfpl APN 19 12,407,393 (GRCm39) missense probably damaging 0.99
pegged UTSW 19 12,406,374 (GRCm39) missense probably damaging 1.00
D3080:Pfpl UTSW 19 12,406,196 (GRCm39) missense probably damaging 0.98
R0276:Pfpl UTSW 19 12,406,601 (GRCm39) missense probably damaging 1.00
R0433:Pfpl UTSW 19 12,406,839 (GRCm39) missense probably damaging 1.00
R1004:Pfpl UTSW 19 12,407,789 (GRCm39) missense probably benign 0.00
R1510:Pfpl UTSW 19 12,407,060 (GRCm39) missense probably benign 0.31
R1759:Pfpl UTSW 19 12,407,224 (GRCm39) missense probably damaging 1.00
R2063:Pfpl UTSW 19 12,407,237 (GRCm39) missense probably damaging 1.00
R2201:Pfpl UTSW 19 12,407,843 (GRCm39) missense probably benign 0.01
R2656:Pfpl UTSW 19 12,407,600 (GRCm39) missense probably benign
R2969:Pfpl UTSW 19 12,406,907 (GRCm39) missense probably benign 0.00
R3003:Pfpl UTSW 19 12,407,690 (GRCm39) missense possibly damaging 0.90
R3428:Pfpl UTSW 19 12,407,677 (GRCm39) missense probably benign 0.37
R3904:Pfpl UTSW 19 12,407,801 (GRCm39) missense probably benign 0.00
R4049:Pfpl UTSW 19 12,407,053 (GRCm39) missense probably damaging 1.00
R4717:Pfpl UTSW 19 12,406,618 (GRCm39) missense probably benign 0.07
R5343:Pfpl UTSW 19 12,406,052 (GRCm39) missense probably damaging 0.99
R5804:Pfpl UTSW 19 12,407,027 (GRCm39) missense probably benign 0.00
R6032:Pfpl UTSW 19 12,406,747 (GRCm39) missense probably damaging 0.99
R6032:Pfpl UTSW 19 12,406,747 (GRCm39) missense probably damaging 0.99
R6047:Pfpl UTSW 19 12,406,597 (GRCm39) missense probably damaging 1.00
R6106:Pfpl UTSW 19 12,406,825 (GRCm39) missense probably damaging 0.99
R6657:Pfpl UTSW 19 12,407,290 (GRCm39) missense probably benign 0.36
R7467:Pfpl UTSW 19 12,405,878 (GRCm39) missense probably damaging 1.00
R7720:Pfpl UTSW 19 12,406,538 (GRCm39) missense probably benign 0.02
R8024:Pfpl UTSW 19 12,407,570 (GRCm39) missense possibly damaging 0.94
R8370:Pfpl UTSW 19 12,407,275 (GRCm39) missense probably damaging 0.99
R8730:Pfpl UTSW 19 12,405,944 (GRCm39) missense probably damaging 1.00
R8974:Pfpl UTSW 19 12,405,839 (GRCm39) missense probably damaging 1.00
R9147:Pfpl UTSW 19 12,405,804 (GRCm39) missense possibly damaging 0.64
R9148:Pfpl UTSW 19 12,405,804 (GRCm39) missense possibly damaging 0.64
R9248:Pfpl UTSW 19 12,406,374 (GRCm39) missense probably damaging 1.00
R9283:Pfpl UTSW 19 12,406,220 (GRCm39) missense probably damaging 1.00
R9542:Pfpl UTSW 19 12,406,297 (GRCm39) missense probably damaging 1.00
R9560:Pfpl UTSW 19 12,406,297 (GRCm39) missense probably damaging 1.00
R9561:Pfpl UTSW 19 12,406,297 (GRCm39) missense probably damaging 1.00
R9663:Pfpl UTSW 19 12,407,459 (GRCm39) missense probably damaging 1.00
R9670:Pfpl UTSW 19 12,407,107 (GRCm39) missense probably damaging 1.00
R9721:Pfpl UTSW 19 12,406,297 (GRCm39) missense probably damaging 1.00
R9722:Pfpl UTSW 19 12,406,297 (GRCm39) missense probably damaging 1.00
R9723:Pfpl UTSW 19 12,406,297 (GRCm39) missense probably damaging 1.00
R9759:Pfpl UTSW 19 12,406,297 (GRCm39) missense probably damaging 1.00
R9761:Pfpl UTSW 19 12,406,297 (GRCm39) missense probably damaging 1.00
R9762:Pfpl UTSW 19 12,406,297 (GRCm39) missense probably damaging 1.00
Z1176:Pfpl UTSW 19 12,407,305 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGCCAAGGCTGAAGTTAGC -3'
(R):5'- AGAGATGCTCGTGTAAAGACTC -3'

Sequencing Primer
(F):5'- CCAAGGCTGAAGTTAGCTCTTATTG -3'
(R):5'- CGTGTAAAGACTCCAGCCTTG -3'
Posted On 2014-08-25