Incidental Mutation 'R1969:Col24a1'
ID219412
Institutional Source Beutler Lab
Gene Symbol Col24a1
Ensembl Gene ENSMUSG00000028197
Gene Namecollagen, type XXIV, alpha 1
Synonyms5430404K19Rik
MMRRC Submission 039982-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1969 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location145292472-145552011 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 145314930 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 354 (I354T)
Ref Sequence ENSEMBL: ENSMUSP00000029848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029848] [ENSMUST00000139001]
Predicted Effect probably benign
Transcript: ENSMUST00000029848
AA Change: I354T

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000029848
Gene: ENSMUSG00000028197
AA Change: I354T

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
TSPN 41 230 2.7e-3 SMART
LamG 106 229 8.07e-2 SMART
Pfam:Collagen 506 565 9.6e-10 PFAM
Pfam:Collagen 561 623 3.4e-10 PFAM
Pfam:Collagen 604 678 2.3e-9 PFAM
low complexity region 682 724 N/A INTRINSIC
Pfam:Collagen 772 837 1.3e-10 PFAM
Pfam:Collagen 865 938 6e-9 PFAM
Pfam:Collagen 967 1042 3.1e-8 PFAM
low complexity region 1056 1075 N/A INTRINSIC
Pfam:Collagen 1107 1180 8e-9 PFAM
Pfam:Collagen 1159 1218 4.2e-10 PFAM
Pfam:Collagen 1218 1279 1.8e-10 PFAM
Pfam:Collagen 1270 1334 3.1e-9 PFAM
Pfam:Collagen 1378 1443 1.3e-9 PFAM
Pfam:Collagen 1439 1500 1.8e-9 PFAM
COLFI 1533 1733 9.34e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139001
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes the alpha-1 subunit of type XXIV collagen, one of the low abundance fibril-forming collagens found in cartilage. The encoded protein has structural features of invertebrate fibrillar collagens and is expressed predominantly in bone tissue. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T C 19: 21,598,245 probably benign Het
1700014D04Rik T C 13: 59,742,785 D407G probably damaging Het
9930021J03Rik C T 19: 29,716,675 S1873N possibly damaging Het
Apoh G A 11: 108,407,462 R196Q probably benign Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
B4galnt4 T C 7: 141,064,848 F194L probably benign Het
BC034090 A T 1: 155,225,226 L431M possibly damaging Het
Bdh2 G T 3: 135,288,279 A31S probably damaging Het
Cacna1s T C 1: 136,119,095 S1821P probably benign Het
Caskin1 A T 17: 24,506,850 Q1370L possibly damaging Het
Ccdc83 T A 7: 90,244,154 S132C probably damaging Het
Cdk15 A T 1: 59,330,951 H384L probably damaging Het
Coro7 T C 16: 4,633,756 I451V probably benign Het
Ctnna2 T C 6: 77,758,500 E65G probably damaging Het
Ctsll3 A T 13: 60,800,348 W172R probably benign Het
D230025D16Rik T A 8: 105,246,500 D247E possibly damaging Het
D630045J12Rik T C 6: 38,168,143 D1316G probably damaging Het
Ddx19b C T 8: 111,008,258 A493T probably benign Het
Ddx4 C T 13: 112,600,013 V608I probably damaging Het
Ddx4 T A 13: 112,620,742 H348L probably damaging Het
Dnah17 G C 11: 118,104,535 Q996E probably benign Het
Dnah9 G C 11: 65,848,371 N4180K probably damaging Het
Dok7 A G 5: 35,077,266 probably null Het
Dpf3 T A 12: 83,325,035 probably null Het
Elfn1 G C 5: 139,972,849 R536P probably damaging Het
Eml6 A G 11: 29,833,075 V602A probably benign Het
Enpp2 T C 15: 54,882,982 D296G probably damaging Het
Evi5 A T 5: 107,748,364 F738I probably benign Het
Eya2 T C 2: 165,716,119 S212P probably benign Het
Fam83a T C 15: 57,986,102 L14P probably damaging Het
Fanca A T 8: 123,288,064 M735K probably benign Het
Fancm T A 12: 65,101,692 S694T probably benign Het
Fibcd1 G A 2: 31,816,661 T386I probably damaging Het
Foxd4 A G 19: 24,899,814 S341P probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Fryl A T 5: 73,098,266 S807R probably benign Het
Fscb T C 12: 64,473,234 E486G unknown Het
Galnt17 A G 5: 131,150,944 S122P probably benign Het
Ghitm A G 14: 37,131,629 F85L probably benign Het
Ghrh C A 2: 157,333,466 V32L probably benign Het
Gli2 C T 1: 118,837,700 R907H probably benign Het
Gm11639 A G 11: 104,746,264 I988M probably damaging Het
Gm28042 A G 2: 120,041,615 *1015W probably null Het
Gpr179 T C 11: 97,337,958 T1124A probably benign Het
Grid2 C A 6: 63,908,918 C99* probably null Het
Grin1 A T 2: 25,297,915 M523K probably benign Het
Gucy2g T C 19: 55,222,896 Y634C possibly damaging Het
Gucy2g T G 19: 55,233,053 T339P probably benign Het
Haus6 A T 4: 86,604,246 L116H probably damaging Het
Hey1 T C 3: 8,666,819 T18A probably benign Het
Hipk3 T C 2: 104,433,841 N792D probably damaging Het
Il19 A T 1: 130,939,156 L29Q probably damaging Het
Il21r A G 7: 125,628,972 Q205R probably damaging Het
Kcnip2 T C 19: 45,793,683 D169G probably null Het
Kctd18 T C 1: 57,967,620 I24V probably benign Het
Lcp1 T C 14: 75,200,506 S119P probably damaging Het
Lig3 G C 11: 82,795,718 D642H probably benign Het
Lrba A G 3: 86,608,389 K2166E probably damaging Het
Lrrn2 T C 1: 132,939,234 V679A probably benign Het
Lyst G A 13: 13,730,344 R3202H probably damaging Het
Micall2 A G 5: 139,736,130 C11R probably damaging Het
Morc2b T G 17: 33,137,091 Q569P probably benign Het
Mtrf1 A G 14: 79,401,671 E81G probably damaging Het
Myh2 G T 11: 67,189,178 S1099I possibly damaging Het
Nap1l1 T A 10: 111,491,053 D158E probably benign Het
Nckap5l T A 15: 99,422,818 T1285S probably damaging Het
Nsrp1 A T 11: 77,045,786 M528K probably damaging Het
Numa1 C T 7: 102,009,322 A1605V probably damaging Het
Nutm2 T C 13: 50,473,842 L453P probably damaging Het
Ofd1 T C X: 166,427,214 Y205C probably benign Het
Olfr1233 T A 2: 89,340,296 N2I probably damaging Het
Olfr135 A G 17: 38,208,464 Y73C probably damaging Het
Olfr19 T A 16: 16,673,583 M133L probably benign Het
Olfr552 A T 7: 102,604,570 D72V probably damaging Het
Olfr693 T A 7: 106,677,670 N272I probably damaging Het
Patl1 T C 19: 11,921,418 L159P probably benign Het
Paxip1 G A 5: 27,744,136 T1045I probably damaging Het
Pik3ca A G 3: 32,451,754 probably null Het
Pkhd1 T A 1: 20,381,523 I2183F probably damaging Het
Plec C T 15: 76,189,172 R319H probably damaging Het
Pnkd G A 1: 74,351,849 G334D probably damaging Het
Prss50 A G 9: 110,862,381 Y251C probably damaging Het
Rab11b A T 17: 33,760,235 Y10N probably damaging Het
Rfc1 G A 5: 65,319,524 R4W probably damaging Het
Rgs19 A T 2: 181,689,483 F119Y probably damaging Het
Safb A G 17: 56,605,821 H883R probably benign Het
Serpine1 G A 5: 137,067,747 Q227* probably null Het
Slc25a13 A G 6: 6,096,668 probably null Het
Slc6a18 T A 13: 73,664,189 T502S possibly damaging Het
Sox4 T C 13: 28,952,648 D125G probably damaging Het
Stag3 C T 5: 138,300,138 T731I probably damaging Het
Thada G T 17: 84,310,042 P1349T probably damaging Het
Tmem245 C A 4: 56,937,964 V195F probably benign Het
Tnxb A G 17: 34,679,081 H901R probably benign Het
Trim39 A T 17: 36,268,753 D103E probably benign Het
Ttn A T 2: 76,731,960 V28847E probably damaging Het
Tubb1 A T 2: 174,455,691 D31V possibly damaging Het
Ush1g A G 11: 115,318,454 S305P probably damaging Het
Vmn1r191 A T 13: 22,178,782 N267K possibly damaging Het
Vmn1r59 A T 7: 5,454,039 Y241N probably damaging Het
Vmn2r49 T C 7: 9,986,308 N419D probably damaging Het
Vps35 T C 8: 85,278,994 D326G possibly damaging Het
Xdh A G 17: 73,892,751 S1187P possibly damaging Het
Xpc A C 6: 91,501,025 probably null Het
Zfp273 T C 13: 67,825,163 Y104H probably damaging Het
Other mutations in Col24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Col24a1 APN 3 145362309 missense probably damaging 1.00
IGL00931:Col24a1 APN 3 145461470 missense probably benign 0.00
IGL01160:Col24a1 APN 3 145507713 missense probably damaging 1.00
IGL01355:Col24a1 APN 3 145314876 missense probably benign 0.07
IGL01409:Col24a1 APN 3 145538564 missense probably benign 0.19
IGL01587:Col24a1 APN 3 145433355 splice site probably null
IGL01666:Col24a1 APN 3 145344686 missense possibly damaging 0.93
IGL01717:Col24a1 APN 3 145524263 splice site probably benign
IGL01721:Col24a1 APN 3 145538567 missense probably benign 0.26
IGL01939:Col24a1 APN 3 145315244 missense probably damaging 1.00
IGL01988:Col24a1 APN 3 145524167 splice site probably null
IGL02002:Col24a1 APN 3 145356944 missense possibly damaging 0.81
IGL02172:Col24a1 APN 3 145314962 missense probably benign 0.34
IGL02552:Col24a1 APN 3 145474207 missense possibly damaging 0.88
IGL02559:Col24a1 APN 3 145314173 missense probably benign
IGL02582:Col24a1 APN 3 145314486 missense probably damaging 1.00
IGL02652:Col24a1 APN 3 145492301 nonsense probably null
IGL02942:Col24a1 APN 3 145541665 missense probably damaging 1.00
IGL03032:Col24a1 APN 3 145538703 critical splice donor site probably null
IGL03108:Col24a1 APN 3 145323401 missense probably damaging 1.00
IGL03310:Col24a1 APN 3 145313983 splice site probably benign
IGL03405:Col24a1 APN 3 145315157 missense possibly damaging 0.73
R0066:Col24a1 UTSW 3 145545144 missense probably damaging 1.00
R0066:Col24a1 UTSW 3 145545144 missense probably damaging 1.00
R0379:Col24a1 UTSW 3 145524142 missense possibly damaging 0.94
R0502:Col24a1 UTSW 3 145545316 splice site probably benign
R0556:Col24a1 UTSW 3 145314728 missense possibly damaging 0.53
R0587:Col24a1 UTSW 3 145293145 missense possibly damaging 0.50
R0617:Col24a1 UTSW 3 145314120 missense probably damaging 1.00
R0831:Col24a1 UTSW 3 145328759 missense probably damaging 1.00
R1455:Col24a1 UTSW 3 145460838 missense probably damaging 1.00
R1664:Col24a1 UTSW 3 145389600 critical splice donor site probably null
R1713:Col24a1 UTSW 3 145366869 nonsense probably null
R1854:Col24a1 UTSW 3 145459140 missense probably damaging 1.00
R1855:Col24a1 UTSW 3 145459140 missense probably damaging 1.00
R1861:Col24a1 UTSW 3 145537267 critical splice donor site probably null
R2216:Col24a1 UTSW 3 145314981 missense probably benign 0.34
R2290:Col24a1 UTSW 3 145513195 missense probably damaging 1.00
R3702:Col24a1 UTSW 3 145337860 missense probably benign 0.01
R3772:Col24a1 UTSW 3 145545286 missense probably damaging 1.00
R4086:Col24a1 UTSW 3 145461437 missense probably damaging 1.00
R4236:Col24a1 UTSW 3 145524282 nonsense probably null
R4433:Col24a1 UTSW 3 145314383 missense possibly damaging 0.95
R4688:Col24a1 UTSW 3 145314383 missense probably benign 0.00
R4972:Col24a1 UTSW 3 145509684 missense probably benign 0.42
R5157:Col24a1 UTSW 3 145345951 nonsense probably null
R5216:Col24a1 UTSW 3 145315310 missense possibly damaging 0.85
R5274:Col24a1 UTSW 3 145484678 missense probably benign 0.03
R5334:Col24a1 UTSW 3 145461525 missense possibly damaging 0.91
R5416:Col24a1 UTSW 3 145315025 nonsense probably null
R5473:Col24a1 UTSW 3 145537261 missense probably benign 0.41
R5538:Col24a1 UTSW 3 145293121 missense probably damaging 0.99
R5561:Col24a1 UTSW 3 145298827 missense probably benign 0.26
R5648:Col24a1 UTSW 3 145358566 missense probably benign 0.00
R5920:Col24a1 UTSW 3 145428230 missense probably damaging 1.00
R6111:Col24a1 UTSW 3 145314054 missense probably damaging 0.99
R6151:Col24a1 UTSW 3 145314054 missense probably damaging 0.99
R6701:Col24a1 UTSW 3 145314380 missense probably benign 0.00
R6728:Col24a1 UTSW 3 145315196 missense probably benign
R6734:Col24a1 UTSW 3 145508674 missense probably benign 0.06
R6861:Col24a1 UTSW 3 145460834 missense probably damaging 1.00
R6982:Col24a1 UTSW 3 145315046 nonsense probably null
R7001:Col24a1 UTSW 3 145298866 missense probably benign 0.28
R7148:Col24a1 UTSW 3 145315299 missense probably damaging 1.00
R7293:Col24a1 UTSW 3 145486304 nonsense probably null
R7315:Col24a1 UTSW 3 145431870 missense possibly damaging 0.82
R7358:Col24a1 UTSW 3 145293165 critical splice donor site probably null
R7371:Col24a1 UTSW 3 145343698 missense probably benign 0.06
R7383:Col24a1 UTSW 3 145298838 missense probably benign
R7605:Col24a1 UTSW 3 145538687 missense possibly damaging 0.67
R7650:Col24a1 UTSW 3 145314453 missense probably benign 0.00
R7679:Col24a1 UTSW 3 145399355 missense possibly damaging 0.81
R7701:Col24a1 UTSW 3 145315011 missense probably benign
R7701:Col24a1 UTSW 3 145366901 splice site probably null
R7805:Col24a1 UTSW 3 145314140 missense probably benign 0.02
R7913:Col24a1 UTSW 3 145431866 nonsense probably null
R7921:Col24a1 UTSW 3 145474238 missense probably damaging 1.00
R8056:Col24a1 UTSW 3 145314164 missense possibly damaging 0.73
R8240:Col24a1 UTSW 3 145507702 missense probably benign 0.31
R8294:Col24a1 UTSW 3 145481089 missense probably null 1.00
R8305:Col24a1 UTSW 3 145474182 missense probably benign 0.00
R8430:Col24a1 UTSW 3 145315299 missense probably damaging 1.00
R8708:Col24a1 UTSW 3 145545265 missense probably damaging 0.99
R8880:Col24a1 UTSW 3 145314037 missense probably null
Z1176:Col24a1 UTSW 3 145342498 missense probably damaging 1.00
Z1177:Col24a1 UTSW 3 145342499 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCACAGAGCAGGATTCCTTGC -3'
(R):5'- GTGTGCAAAGCCGGATGATG -3'

Sequencing Primer
(F):5'- GCAGGATTCCTTGCCAAAAG -3'
(R):5'- AAGCCGGATGATGCTTTCTTAG -3'
Posted On2014-08-25