Incidental Mutation 'R1969:Dnah9'
ID219489
Institutional Source Beutler Lab
Gene Symbol Dnah9
Ensembl Gene ENSMUSG00000056752
Gene Namedynein, axonemal, heavy chain 9
SynonymsD11Ertd686e, Dnahc9
MMRRC Submission 039982-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.236) question?
Stock #R1969 (G1)
Quality Score150
Status Not validated
Chromosome11
Chromosomal Location65831282-66168551 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 65848371 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 4180 (N4180K)
Ref Sequence ENSEMBL: ENSMUSP00000079494 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080665]
Predicted Effect probably damaging
Transcript: ENSMUST00000080665
AA Change: N4180K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000079494
Gene: ENSMUSG00000056752
AA Change: N4180K

DomainStartEndE-ValueType
Pfam:DHC_N1 209 787 3.6e-164 PFAM
coiled coil region 788 820 N/A INTRINSIC
low complexity region 1228 1240 N/A INTRINSIC
Pfam:DHC_N2 1290 1699 1.4e-134 PFAM
AAA 1863 1999 4.9e-1 SMART
AAA 2141 2341 1.99e0 SMART
AAA 2468 2614 6.75e-1 SMART
Pfam:AAA_8 2786 3053 1.1e-165 PFAM
Pfam:MT 3065 3408 7.2e-208 PFAM
Pfam:AAA_9 3430 3652 3.2e-87 PFAM
Pfam:Dynein_heavy 3786 4482 1e-241 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136124
Predicted Effect unknown
Transcript: ENSMUST00000152386
AA Change: N1653K
SMART Domains Protein: ENSMUSP00000116499
Gene: ENSMUSG00000056752
AA Change: N1653K

DomainStartEndE-ValueType
Pfam:AAA_7 1 258 3e-155 PFAM
Pfam:AAA_8 336 603 3.9e-166 PFAM
Pfam:MT 615 958 2.3e-208 PFAM
Pfam:AAA_9 980 1202 1.1e-87 PFAM
Pfam:Dynein_heavy 1336 1514 2.4e-52 PFAM
Pfam:Dynein_heavy 1508 1956 8.6e-155 PFAM
Meta Mutation Damage Score 0.8606 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the heavy chain subunit of axonemal dynein, a large multi-subunit molecular motor. Axonemal dynein attaches to microtubules and hydrolyzes ATP to mediate the movement of cilia and flagella. The gene expresses at least two transcript variants; additional variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T C 19: 21,598,245 probably benign Het
1700014D04Rik T C 13: 59,742,785 D407G probably damaging Het
9930021J03Rik C T 19: 29,716,675 S1873N possibly damaging Het
Apoh G A 11: 108,407,462 R196Q probably benign Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
B4galnt4 T C 7: 141,064,848 F194L probably benign Het
BC034090 A T 1: 155,225,226 L431M possibly damaging Het
Bdh2 G T 3: 135,288,279 A31S probably damaging Het
Cacna1s T C 1: 136,119,095 S1821P probably benign Het
Caskin1 A T 17: 24,506,850 Q1370L possibly damaging Het
Ccdc83 T A 7: 90,244,154 S132C probably damaging Het
Cdk15 A T 1: 59,330,951 H384L probably damaging Het
Col24a1 T C 3: 145,314,930 I354T probably benign Het
Coro7 T C 16: 4,633,756 I451V probably benign Het
Ctnna2 T C 6: 77,758,500 E65G probably damaging Het
Ctsll3 A T 13: 60,800,348 W172R probably benign Het
D230025D16Rik T A 8: 105,246,500 D247E possibly damaging Het
D630045J12Rik T C 6: 38,168,143 D1316G probably damaging Het
Ddx19b C T 8: 111,008,258 A493T probably benign Het
Ddx4 C T 13: 112,600,013 V608I probably damaging Het
Ddx4 T A 13: 112,620,742 H348L probably damaging Het
Dnah17 G C 11: 118,104,535 Q996E probably benign Het
Dok7 A G 5: 35,077,266 probably null Het
Dpf3 T A 12: 83,325,035 probably null Het
Elfn1 G C 5: 139,972,849 R536P probably damaging Het
Eml6 A G 11: 29,833,075 V602A probably benign Het
Enpp2 T C 15: 54,882,982 D296G probably damaging Het
Evi5 A T 5: 107,748,364 F738I probably benign Het
Eya2 T C 2: 165,716,119 S212P probably benign Het
Fam83a T C 15: 57,986,102 L14P probably damaging Het
Fanca A T 8: 123,288,064 M735K probably benign Het
Fancm T A 12: 65,101,692 S694T probably benign Het
Fibcd1 G A 2: 31,816,661 T386I probably damaging Het
Foxd4 A G 19: 24,899,814 S341P probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Fryl A T 5: 73,098,266 S807R probably benign Het
Fscb T C 12: 64,473,234 E486G unknown Het
Galnt17 A G 5: 131,150,944 S122P probably benign Het
Ghitm A G 14: 37,131,629 F85L probably benign Het
Ghrh C A 2: 157,333,466 V32L probably benign Het
Gli2 C T 1: 118,837,700 R907H probably benign Het
Gm11639 A G 11: 104,746,264 I988M probably damaging Het
Gm28042 A G 2: 120,041,615 *1015W probably null Het
Gpr179 T C 11: 97,337,958 T1124A probably benign Het
Grid2 C A 6: 63,908,918 C99* probably null Het
Grin1 A T 2: 25,297,915 M523K probably benign Het
Gucy2g T C 19: 55,222,896 Y634C possibly damaging Het
Gucy2g T G 19: 55,233,053 T339P probably benign Het
Haus6 A T 4: 86,604,246 L116H probably damaging Het
Hey1 T C 3: 8,666,819 T18A probably benign Het
Hipk3 T C 2: 104,433,841 N792D probably damaging Het
Il19 A T 1: 130,939,156 L29Q probably damaging Het
Il21r A G 7: 125,628,972 Q205R probably damaging Het
Kcnip2 T C 19: 45,793,683 D169G probably null Het
Kctd18 T C 1: 57,967,620 I24V probably benign Het
Lcp1 T C 14: 75,200,506 S119P probably damaging Het
Lig3 G C 11: 82,795,718 D642H probably benign Het
Lrba A G 3: 86,608,389 K2166E probably damaging Het
Lrrn2 T C 1: 132,939,234 V679A probably benign Het
Lyst G A 13: 13,730,344 R3202H probably damaging Het
Micall2 A G 5: 139,736,130 C11R probably damaging Het
Morc2b T G 17: 33,137,091 Q569P probably benign Het
Mtrf1 A G 14: 79,401,671 E81G probably damaging Het
Myh2 G T 11: 67,189,178 S1099I possibly damaging Het
Nap1l1 T A 10: 111,491,053 D158E probably benign Het
Nckap5l T A 15: 99,422,818 T1285S probably damaging Het
Nsrp1 A T 11: 77,045,786 M528K probably damaging Het
Numa1 C T 7: 102,009,322 A1605V probably damaging Het
Nutm2 T C 13: 50,473,842 L453P probably damaging Het
Ofd1 T C X: 166,427,214 Y205C probably benign Het
Olfr1233 T A 2: 89,340,296 N2I probably damaging Het
Olfr135 A G 17: 38,208,464 Y73C probably damaging Het
Olfr19 T A 16: 16,673,583 M133L probably benign Het
Olfr552 A T 7: 102,604,570 D72V probably damaging Het
Olfr693 T A 7: 106,677,670 N272I probably damaging Het
Patl1 T C 19: 11,921,418 L159P probably benign Het
Paxip1 G A 5: 27,744,136 T1045I probably damaging Het
Pik3ca A G 3: 32,451,754 probably null Het
Pkhd1 T A 1: 20,381,523 I2183F probably damaging Het
Plec C T 15: 76,189,172 R319H probably damaging Het
Pnkd G A 1: 74,351,849 G334D probably damaging Het
Prss50 A G 9: 110,862,381 Y251C probably damaging Het
Rab11b A T 17: 33,760,235 Y10N probably damaging Het
Rfc1 G A 5: 65,319,524 R4W probably damaging Het
Rgs19 A T 2: 181,689,483 F119Y probably damaging Het
Safb A G 17: 56,605,821 H883R probably benign Het
Serpine1 G A 5: 137,067,747 Q227* probably null Het
Slc25a13 A G 6: 6,096,668 probably null Het
Slc6a18 T A 13: 73,664,189 T502S possibly damaging Het
Sox4 T C 13: 28,952,648 D125G probably damaging Het
Stag3 C T 5: 138,300,138 T731I probably damaging Het
Thada G T 17: 84,310,042 P1349T probably damaging Het
Tmem245 C A 4: 56,937,964 V195F probably benign Het
Tnxb A G 17: 34,679,081 H901R probably benign Het
Trim39 A T 17: 36,268,753 D103E probably benign Het
Ttn A T 2: 76,731,960 V28847E probably damaging Het
Tubb1 A T 2: 174,455,691 D31V possibly damaging Het
Ush1g A G 11: 115,318,454 S305P probably damaging Het
Vmn1r191 A T 13: 22,178,782 N267K possibly damaging Het
Vmn1r59 A T 7: 5,454,039 Y241N probably damaging Het
Vmn2r49 T C 7: 9,986,308 N419D probably damaging Het
Vps35 T C 8: 85,278,994 D326G possibly damaging Het
Xdh A G 17: 73,892,751 S1187P possibly damaging Het
Xpc A C 6: 91,501,025 probably null Het
Zfp273 T C 13: 67,825,163 Y104H probably damaging Het
Other mutations in Dnah9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00696:Dnah9 APN 11 65841238 splice site probably benign
IGL00805:Dnah9 APN 11 65881695 missense probably benign 0.00
IGL00826:Dnah9 APN 11 65989942 missense probably damaging 1.00
IGL01108:Dnah9 APN 11 65849980 missense possibly damaging 0.93
IGL01152:Dnah9 APN 11 66072056 missense probably damaging 1.00
IGL01353:Dnah9 APN 11 66080571 missense probably damaging 1.00
IGL01364:Dnah9 APN 11 66155459 missense probably damaging 1.00
IGL01479:Dnah9 APN 11 65955717 missense probably benign 0.14
IGL01537:Dnah9 APN 11 65947680 missense probably benign
IGL01565:Dnah9 APN 11 66033829 missense possibly damaging 0.95
IGL01597:Dnah9 APN 11 66118830 missense probably damaging 1.00
IGL01619:Dnah9 APN 11 65831615 nonsense probably null
IGL01625:Dnah9 APN 11 66044645 missense probably damaging 1.00
IGL01803:Dnah9 APN 11 66118829 missense probably damaging 1.00
IGL01819:Dnah9 APN 11 66108126 missense probably benign 0.33
IGL01896:Dnah9 APN 11 66130666 missense possibly damaging 0.89
IGL01922:Dnah9 APN 11 66075034 splice site probably benign
IGL01923:Dnah9 APN 11 66125235 splice site probably benign
IGL02059:Dnah9 APN 11 66072958 missense probably damaging 1.00
IGL02068:Dnah9 APN 11 66061045 missense probably damaging 1.00
IGL02135:Dnah9 APN 11 66117492 missense possibly damaging 0.63
IGL02146:Dnah9 APN 11 65927700 missense probably damaging 1.00
IGL02264:Dnah9 APN 11 66080488 splice site probably benign
IGL02325:Dnah9 APN 11 65834217 missense probably damaging 1.00
IGL02426:Dnah9 APN 11 66125153 missense probably benign
IGL02440:Dnah9 APN 11 65955246 missense probably damaging 1.00
IGL02471:Dnah9 APN 11 65947618 nonsense probably null
IGL02496:Dnah9 APN 11 66029363 missense probably damaging 1.00
IGL02672:Dnah9 APN 11 65927601 missense probably benign 0.02
IGL02718:Dnah9 APN 11 65886640 missense probably damaging 0.99
IGL02832:Dnah9 APN 11 66040346 missense probably damaging 1.00
IGL02851:Dnah9 APN 11 66037744 splice site probably benign
IGL02859:Dnah9 APN 11 65881619 splice site probably benign
IGL02864:Dnah9 APN 11 66061003 missense probably damaging 1.00
IGL02954:Dnah9 APN 11 66118967 missense probably damaging 1.00
IGL02987:Dnah9 APN 11 65855272 missense probably damaging 0.98
IGL02987:Dnah9 APN 11 65841273 missense probably benign 0.23
IGL03160:Dnah9 APN 11 66108054 missense probably damaging 0.98
IGL03171:Dnah9 APN 11 65981241 missense probably benign 0.13
IGL03180:Dnah9 APN 11 65886639 missense probably damaging 0.99
IGL03388:Dnah9 APN 11 65947542 missense probably damaging 1.00
anarchy UTSW 11 65955248 missense probably damaging 0.99
sacco UTSW 11 66168079 missense possibly damaging 0.82
vanzetti UTSW 11 65855372 nonsense probably null
IGL02837:Dnah9 UTSW 11 65874196 missense probably damaging 1.00
PIT4280001:Dnah9 UTSW 11 66005013 missense probably benign 0.44
R0021:Dnah9 UTSW 11 65969979 missense probably benign 0.36
R0021:Dnah9 UTSW 11 65969979 missense probably benign 0.36
R0025:Dnah9 UTSW 11 65969955 splice site probably benign
R0025:Dnah9 UTSW 11 65969955 splice site probably benign
R0070:Dnah9 UTSW 11 66160040 missense probably benign 0.10
R0164:Dnah9 UTSW 11 65918804 nonsense probably null
R0164:Dnah9 UTSW 11 65918804 nonsense probably null
R0180:Dnah9 UTSW 11 66147290 missense probably damaging 1.00
R0195:Dnah9 UTSW 11 65895905 missense probably benign 0.30
R0230:Dnah9 UTSW 11 65855315 missense probably damaging 1.00
R0243:Dnah9 UTSW 11 65911852 missense possibly damaging 0.91
R0279:Dnah9 UTSW 11 65911789 critical splice donor site probably null
R0288:Dnah9 UTSW 11 66025134 critical splice donor site probably null
R0309:Dnah9 UTSW 11 66026972 splice site probably benign
R0356:Dnah9 UTSW 11 66130562 critical splice donor site probably null
R0403:Dnah9 UTSW 11 66084789 missense possibly damaging 0.90
R0413:Dnah9 UTSW 11 66108135 missense probably damaging 1.00
R0448:Dnah9 UTSW 11 65918713 splice site probably benign
R0496:Dnah9 UTSW 11 66075135 missense probably null 1.00
R0557:Dnah9 UTSW 11 66084666 missense probably damaging 1.00
R0584:Dnah9 UTSW 11 65990489 missense probably damaging 1.00
R0598:Dnah9 UTSW 11 66118877 missense probably benign 0.02
R0599:Dnah9 UTSW 11 65965689 missense probably damaging 1.00
R0606:Dnah9 UTSW 11 65841333 missense probably damaging 1.00
R0666:Dnah9 UTSW 11 66085458 missense probably benign 0.01
R0715:Dnah9 UTSW 11 66081248 splice site probably benign
R0726:Dnah9 UTSW 11 65965681 missense probably damaging 1.00
R0737:Dnah9 UTSW 11 66107898 missense probably damaging 1.00
R0763:Dnah9 UTSW 11 66155530 missense probably benign 0.30
R0792:Dnah9 UTSW 11 65896001 missense possibly damaging 0.84
R0829:Dnah9 UTSW 11 66005176 missense probably benign 0.00
R0973:Dnah9 UTSW 11 66005837 unclassified probably null
R0974:Dnah9 UTSW 11 66005837 unclassified probably null
R1055:Dnah9 UTSW 11 66160011 missense probably damaging 1.00
R1081:Dnah9 UTSW 11 66084877 missense probably damaging 0.99
R1184:Dnah9 UTSW 11 66084612 critical splice donor site probably null
R1225:Dnah9 UTSW 11 65871060 missense possibly damaging 0.94
R1304:Dnah9 UTSW 11 65927588 missense probably damaging 0.98
R1417:Dnah9 UTSW 11 65955747 missense probably damaging 0.96
R1439:Dnah9 UTSW 11 65874132 missense probably benign 0.22
R1447:Dnah9 UTSW 11 66108482 missense possibly damaging 0.65
R1450:Dnah9 UTSW 11 65927786 missense probably damaging 1.00
R1470:Dnah9 UTSW 11 65927822 missense probably benign 0.11
R1470:Dnah9 UTSW 11 65927822 missense probably benign 0.11
R1486:Dnah9 UTSW 11 65834272 missense probably damaging 1.00
R1519:Dnah9 UTSW 11 65881761 missense probably damaging 0.96
R1570:Dnah9 UTSW 11 66112330 missense probably benign
R1617:Dnah9 UTSW 11 65895921 missense probably damaging 1.00
R1623:Dnah9 UTSW 11 66037637 missense probably damaging 1.00
R1626:Dnah9 UTSW 11 66085267 missense probably benign 0.05
R1671:Dnah9 UTSW 11 65927963 missense probably damaging 0.99
R1694:Dnah9 UTSW 11 65954824 nonsense probably null
R1701:Dnah9 UTSW 11 65911924 missense probably damaging 1.00
R1702:Dnah9 UTSW 11 66085195 missense possibly damaging 0.72
R1708:Dnah9 UTSW 11 65915154 missense probably benign 0.11
R1718:Dnah9 UTSW 11 66168079 missense possibly damaging 0.82
R1729:Dnah9 UTSW 11 66085020 missense possibly damaging 0.51
R1760:Dnah9 UTSW 11 65981222 missense probably benign 0.31
R1784:Dnah9 UTSW 11 66085020 missense possibly damaging 0.51
R1793:Dnah9 UTSW 11 66119594 critical splice donor site probably null
R1801:Dnah9 UTSW 11 65955297 missense probably damaging 0.99
R1827:Dnah9 UTSW 11 65850061 missense probably damaging 0.97
R1836:Dnah9 UTSW 11 66118841 missense probably benign 0.10
R1840:Dnah9 UTSW 11 65834198 nonsense probably null
R1847:Dnah9 UTSW 11 65834386 missense probably damaging 1.00
R1872:Dnah9 UTSW 11 66037490 missense probably benign 0.16
R1929:Dnah9 UTSW 11 65976398 missense probably benign 0.05
R1971:Dnah9 UTSW 11 65848371 missense probably damaging 1.00
R2027:Dnah9 UTSW 11 65955338 missense probably benign 0.11
R2049:Dnah9 UTSW 11 66044683 missense probably damaging 1.00
R2064:Dnah9 UTSW 11 66145435 missense probably benign 0.31
R2104:Dnah9 UTSW 11 66061124 missense probably damaging 1.00
R2109:Dnah9 UTSW 11 66037585 missense probably damaging 1.00
R2160:Dnah9 UTSW 11 66117483 missense probably damaging 1.00
R2172:Dnah9 UTSW 11 66072779 missense probably damaging 1.00
R2198:Dnah9 UTSW 11 65859499 missense possibly damaging 0.50
R2271:Dnah9 UTSW 11 66112362 missense probably benign 0.37
R2272:Dnah9 UTSW 11 66112362 missense probably benign 0.37
R2396:Dnah9 UTSW 11 66085158 missense probably benign 0.01
R2398:Dnah9 UTSW 11 65915203 missense probably damaging 1.00
R2418:Dnah9 UTSW 11 66095415 nonsense probably null
R2419:Dnah9 UTSW 11 66095415 nonsense probably null
R2510:Dnah9 UTSW 11 66005169 missense probably damaging 1.00
R2680:Dnah9 UTSW 11 66033925 missense probably benign 0.00
R2875:Dnah9 UTSW 11 66168461 missense possibly damaging 0.89
R2979:Dnah9 UTSW 11 66117588 missense possibly damaging 0.89
R3236:Dnah9 UTSW 11 65954989 missense probably benign 0.11
R3237:Dnah9 UTSW 11 65954989 missense probably benign 0.11
R3433:Dnah9 UTSW 11 66075112 missense possibly damaging 0.85
R3737:Dnah9 UTSW 11 66156908 nonsense probably null
R3820:Dnah9 UTSW 11 65851003 critical splice donor site probably null
R3821:Dnah9 UTSW 11 65851003 critical splice donor site probably null
R3822:Dnah9 UTSW 11 65851003 critical splice donor site probably null
R3861:Dnah9 UTSW 11 66052994 splice site probably benign
R3918:Dnah9 UTSW 11 65870974 missense possibly damaging 0.54
R4011:Dnah9 UTSW 11 65834464 missense probably damaging 0.98
R4044:Dnah9 UTSW 11 66133635 missense probably benign 0.03
R4072:Dnah9 UTSW 11 66084904 missense probably benign 0.00
R4076:Dnah9 UTSW 11 66084904 missense probably benign 0.00
R4097:Dnah9 UTSW 11 65990459 missense probably damaging 1.00
R4409:Dnah9 UTSW 11 66085477 missense possibly damaging 0.51
R4410:Dnah9 UTSW 11 66085477 missense possibly damaging 0.51
R4417:Dnah9 UTSW 11 65981214 missense possibly damaging 0.75
R4420:Dnah9 UTSW 11 66118749 missense probably benign 0.00
R4434:Dnah9 UTSW 11 66108075 missense possibly damaging 0.67
R4451:Dnah9 UTSW 11 65881641 missense probably benign 0.07
R4452:Dnah9 UTSW 11 66027082 missense probably damaging 0.96
R4454:Dnah9 UTSW 11 66147389 missense probably damaging 0.96
R4551:Dnah9 UTSW 11 65841366 missense probably damaging 1.00
R4552:Dnah9 UTSW 11 65841366 missense probably damaging 1.00
R4590:Dnah9 UTSW 11 66040392 missense probably damaging 1.00
R4595:Dnah9 UTSW 11 66168152 missense probably benign
R4655:Dnah9 UTSW 11 65955732 missense probably benign 0.00
R4667:Dnah9 UTSW 11 66155531 missense probably benign
R4718:Dnah9 UTSW 11 66085473 missense probably benign
R4720:Dnah9 UTSW 11 66076358 missense probably damaging 1.00
R4734:Dnah9 UTSW 11 65834115 missense probably damaging 1.00
R4749:Dnah9 UTSW 11 65834115 missense probably damaging 1.00
R4765:Dnah9 UTSW 11 65927726 missense probably damaging 1.00
R4905:Dnah9 UTSW 11 65874124 nonsense probably null
R4963:Dnah9 UTSW 11 66084611 splice site probably null
R5074:Dnah9 UTSW 11 65850040 missense probably damaging 1.00
R5230:Dnah9 UTSW 11 66084666 missense probably damaging 0.99
R5262:Dnah9 UTSW 11 66112333 missense probably benign 0.34
R5364:Dnah9 UTSW 11 65881696 missense possibly damaging 0.93
R5370:Dnah9 UTSW 11 66029354 missense probably damaging 1.00
R5386:Dnah9 UTSW 11 66029356 missense probably damaging 1.00
R5389:Dnah9 UTSW 11 66095314 nonsense probably null
R5541:Dnah9 UTSW 11 66145336 missense probably damaging 1.00
R5560:Dnah9 UTSW 11 65881740 missense probably benign 0.00
R5576:Dnah9 UTSW 11 65834096 splice site probably null
R5648:Dnah9 UTSW 11 65927755 missense probably benign 0.00
R5653:Dnah9 UTSW 11 65849980 missense probably damaging 0.99
R5713:Dnah9 UTSW 11 66025223 missense possibly damaging 0.92
R5763:Dnah9 UTSW 11 65955239 missense probably damaging 1.00
R5825:Dnah9 UTSW 11 66126601 missense probably benign 0.01
R5831:Dnah9 UTSW 11 66108121 missense probably benign 0.00
R5847:Dnah9 UTSW 11 66095240 frame shift probably null
R5870:Dnah9 UTSW 11 66085210 missense probably benign 0.01
R5902:Dnah9 UTSW 11 66025187 missense probably benign 0.08
R5918:Dnah9 UTSW 11 65834199 missense probably damaging 1.00
R5979:Dnah9 UTSW 11 65834481 missense probably damaging 1.00
R6065:Dnah9 UTSW 11 65855338 missense probably benign 0.05
R6065:Dnah9 UTSW 11 66145397 missense possibly damaging 0.65
R6086:Dnah9 UTSW 11 65989915 missense probably damaging 0.99
R6086:Dnah9 UTSW 11 66085174 missense probably benign
R6102:Dnah9 UTSW 11 65990516 missense probably damaging 0.97
R6120:Dnah9 UTSW 11 66147399 missense probably benign
R6154:Dnah9 UTSW 11 65855338 missense probably benign 0.00
R6262:Dnah9 UTSW 11 65881805 splice site probably null
R6265:Dnah9 UTSW 11 66168094 missense probably benign 0.04
R6290:Dnah9 UTSW 11 65841375 missense probably damaging 1.00
R6345:Dnah9 UTSW 11 66037693 missense probably damaging 0.97
R6357:Dnah9 UTSW 11 65874196 missense probably damaging 1.00
R6534:Dnah9 UTSW 11 65955248 missense probably damaging 0.99
R6574:Dnah9 UTSW 11 66168281 missense probably benign 0.37
R6582:Dnah9 UTSW 11 66061097 missense probably damaging 1.00
R6700:Dnah9 UTSW 11 65955366 missense probably damaging 1.00
R6800:Dnah9 UTSW 11 66072739 critical splice donor site probably null
R6812:Dnah9 UTSW 11 65981329 missense probably damaging 0.99
R6931:Dnah9 UTSW 11 66117626 missense possibly damaging 0.63
R6944:Dnah9 UTSW 11 66085149 missense possibly damaging 0.91
R6958:Dnah9 UTSW 11 66076341 missense probably damaging 1.00
R6977:Dnah9 UTSW 11 66107909 missense probably benign 0.37
R7021:Dnah9 UTSW 11 65981231 missense probably benign
R7161:Dnah9 UTSW 11 65855372 nonsense probably null
R7175:Dnah9 UTSW 11 66133637 missense probably benign 0.03
R7199:Dnah9 UTSW 11 66118944 missense probably benign 0.04
R7231:Dnah9 UTSW 11 65965647 missense probably damaging 1.00
R7284:Dnah9 UTSW 11 65990476 missense probably damaging 0.99
R7314:Dnah9 UTSW 11 65989851 missense probably benign 0.00
R7350:Dnah9 UTSW 11 66080578 missense probably damaging 1.00
R7420:Dnah9 UTSW 11 66117407 critical splice donor site probably null
R7427:Dnah9 UTSW 11 65955219 missense probably benign
R7477:Dnah9 UTSW 11 65992731 missense probably damaging 0.98
R7515:Dnah9 UTSW 11 65841414 missense probably benign 0.01
R7521:Dnah9 UTSW 11 65989837 missense probably damaging 0.98
R7573:Dnah9 UTSW 11 66125215 missense probably benign 0.43
V3553:Dnah9 UTSW 11 65970076 missense probably damaging 1.00
X0027:Dnah9 UTSW 11 66085479 missense probably benign 0.07
X0028:Dnah9 UTSW 11 65990452 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTAGTCACCCTACCACTACTGAAG -3'
(R):5'- GTGCTGAGTAGTAACTGTGCC -3'

Sequencing Primer
(F):5'- CCTACCACTACTGAAGTTATTTGCAG -3'
(R):5'- AACTGTGCCTGGTATGTGAAGTAAG -3'
Posted On2014-08-25