Mutagenetix > Incidental Mutation

Incidental Mutation 'R1969:Dnah9'

219489

Institutional Source

Beutler Lab

Gene Symbol

Dnah9

Ensembl Gene

ENSMUSG00000056752

Gene Name

dynein, axonemal, heavy chain 9

Synonyms

D11Ertd686e, Dnahc9

MMRRC Submission

039982-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.346) question?

Stock #

R1969 (G1)

Quality Score

150

Status

Not validated

Chromosome

Chromosomal Location

65831282-66168551 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 65848371 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 4180 (N4180K)

Ref Sequence

ENSEMBL: ENSMUSP00000079494 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000080665]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000080665
AA Change: N4180K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000079494
Gene: ENSMUSG00000056752
AA Change: N4180K

Domain	Start	End	E-Value	Type
Pfam:DHC_N1	209	787	3.6e-164	PFAM
coiled coil region	788	820	N/A	INTRINSIC
low complexity region	1228	1240	N/A	INTRINSIC
Pfam:DHC_N2	1290	1699	1.4e-134	PFAM
AAA	1863	1999	4.9e-1	SMART
AAA	2141	2341	1.99e0	SMART
AAA	2468	2614	6.75e-1	SMART
Pfam:AAA_8	2786	3053	1.1e-165	PFAM
Pfam:MT	3065	3408	7.2e-208	PFAM
Pfam:AAA_9	3430	3652	3.2e-87	PFAM
Pfam:Dynein_heavy	3786	4482	1e-241	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136124

Predicted Effect

unknown
Transcript: ENSMUST00000152386
AA Change: N1653K

SMART Domains

Protein: ENSMUSP00000116499
Gene: ENSMUSG00000056752
AA Change: N1653K

Domain	Start	End	E-Value	Type
Pfam:AAA_7	1	258	3e-155	PFAM
Pfam:AAA_8	336	603	3.9e-166	PFAM
Pfam:MT	615	958	2.3e-208	PFAM
Pfam:AAA_9	980	1202	1.1e-87	PFAM
Pfam:Dynein_heavy	1336	1514	2.4e-52	PFAM
Pfam:Dynein_heavy	1508	1956	8.6e-155	PFAM

Meta Mutation Damage Score

0.8606

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the heavy chain subunit of axonemal dynein, a large multi-subunit molecular motor. Axonemal dynein attaches to microtubules and hydrolyzes ATP to mediate the movement of cilia and flagella. The gene expresses at least two transcript variants; additional variants have been described, but their full length nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110059E24Rik	T	C	19: 21,598,245		probably benign	Het
1700014D04Rik	T	C	13: 59,742,785	D407G	probably damaging	Het
9930021J03Rik	C	T	19: 29,716,675	S1873N	possibly damaging	Het
Apoh	G	A	11: 108,407,462	R196Q	probably benign	Het
Arnt	C	T	3: 95,448,393	S16L	possibly damaging	Het
B4galnt4	T	C	7: 141,064,848	F194L	probably benign	Het
BC034090	A	T	1: 155,225,226	L431M	possibly damaging	Het
Bdh2	G	T	3: 135,288,279	A31S	probably damaging	Het
Cacna1s	T	C	1: 136,119,095	S1821P	probably benign	Het
Caskin1	A	T	17: 24,506,850	Q1370L	possibly damaging	Het
Ccdc83	T	A	7: 90,244,154	S132C	probably damaging	Het
Cdk15	A	T	1: 59,330,951	H384L	probably damaging	Het
Col24a1	T	C	3: 145,314,930	I354T	probably benign	Het
Coro7	T	C	16: 4,633,756	I451V	probably benign	Het
Ctnna2	T	C	6: 77,758,500	E65G	probably damaging	Het
Ctsll3	A	T	13: 60,800,348	W172R	probably benign	Het
D230025D16Rik	T	A	8: 105,246,500	D247E	possibly damaging	Het
D630045J12Rik	T	C	6: 38,168,143	D1316G	probably damaging	Het
Ddx19b	C	T	8: 111,008,258	A493T	probably benign	Het
Ddx4	C	T	13: 112,600,013	V608I	probably damaging	Het
Ddx4	T	A	13: 112,620,742	H348L	probably damaging	Het
Dnah17	G	C	11: 118,104,535	Q996E	probably benign	Het
Dok7	A	G	5: 35,077,266		probably null	Het
Dpf3	T	A	12: 83,325,035		probably null	Het
Elfn1	G	C	5: 139,972,849	R536P	probably damaging	Het
Eml6	A	G	11: 29,833,075	V602A	probably benign	Het
Enpp2	T	C	15: 54,882,982	D296G	probably damaging	Het
Evi5	A	T	5: 107,748,364	F738I	probably benign	Het
Eya2	T	C	2: 165,716,119	S212P	probably benign	Het
Fam83a	T	C	15: 57,986,102	L14P	probably damaging	Het
Fanca	A	T	8: 123,288,064	M735K	probably benign	Het
Fancm	T	A	12: 65,101,692	S694T	probably benign	Het
Fibcd1	G	A	2: 31,816,661	T386I	probably damaging	Het
Foxd4	A	G	19: 24,899,814	S341P	probably benign	Het
Foxp4	C	T	17: 47,875,871	R378Q	unknown	Het
Fryl	A	T	5: 73,098,266	S807R	probably benign	Het
Fscb	T	C	12: 64,473,234	E486G	unknown	Het
Galnt17	A	G	5: 131,150,944	S122P	probably benign	Het
Ghitm	A	G	14: 37,131,629	F85L	probably benign	Het
Ghrh	C	A	2: 157,333,466	V32L	probably benign	Het
Gli2	C	T	1: 118,837,700	R907H	probably benign	Het
Gm11639	A	G	11: 104,746,264	I988M	probably damaging	Het
Gm28042	A	G	2: 120,041,615	*1015W	probably null	Het
Gpr179	T	C	11: 97,337,958	T1124A	probably benign	Het
Grid2	C	A	6: 63,908,918	C99*	probably null	Het
Grin1	A	T	2: 25,297,915	M523K	probably benign	Het
Gucy2g	T	C	19: 55,222,896	Y634C	possibly damaging	Het
Gucy2g	T	G	19: 55,233,053	T339P	probably benign	Het
Haus6	A	T	4: 86,604,246	L116H	probably damaging	Het
Hey1	T	C	3: 8,666,819	T18A	probably benign	Het
Hipk3	T	C	2: 104,433,841	N792D	probably damaging	Het
Il19	A	T	1: 130,939,156	L29Q	probably damaging	Het
Il21r	A	G	7: 125,628,972	Q205R	probably damaging	Het
Kcnip2	T	C	19: 45,793,683	D169G	probably null	Het
Kctd18	T	C	1: 57,967,620	I24V	probably benign	Het
Lcp1	T	C	14: 75,200,506	S119P	probably damaging	Het
Lig3	G	C	11: 82,795,718	D642H	probably benign	Het
Lrba	A	G	3: 86,608,389	K2166E	probably damaging	Het
Lrrn2	T	C	1: 132,939,234	V679A	probably benign	Het
Lyst	G	A	13: 13,730,344	R3202H	probably damaging	Het
Micall2	A	G	5: 139,736,130	C11R	probably damaging	Het
Morc2b	T	G	17: 33,137,091	Q569P	probably benign	Het
Mtrf1	A	G	14: 79,401,671	E81G	probably damaging	Het
Myh2	G	T	11: 67,189,178	S1099I	possibly damaging	Het
Nap1l1	T	A	10: 111,491,053	D158E	probably benign	Het
Nckap5l	T	A	15: 99,422,818	T1285S	probably damaging	Het
Nsrp1	A	T	11: 77,045,786	M528K	probably damaging	Het
Numa1	C	T	7: 102,009,322	A1605V	probably damaging	Het
Nutm2	T	C	13: 50,473,842	L453P	probably damaging	Het
Ofd1	T	C	X: 166,427,214	Y205C	probably benign	Het
Olfr1233	T	A	2: 89,340,296	N2I	probably damaging	Het
Olfr135	A	G	17: 38,208,464	Y73C	probably damaging	Het
Olfr19	T	A	16: 16,673,583	M133L	probably benign	Het
Olfr552	A	T	7: 102,604,570	D72V	probably damaging	Het
Olfr693	T	A	7: 106,677,670	N272I	probably damaging	Het
Patl1	T	C	19: 11,921,418	L159P	probably benign	Het
Paxip1	G	A	5: 27,744,136	T1045I	probably damaging	Het
Pik3ca	A	G	3: 32,451,754		probably null	Het
Pkhd1	T	A	1: 20,381,523	I2183F	probably damaging	Het
Plec	C	T	15: 76,189,172	R319H	probably damaging	Het
Pnkd	G	A	1: 74,351,849	G334D	probably damaging	Het
Prss50	A	G	9: 110,862,381	Y251C	probably damaging	Het
Rab11b	A	T	17: 33,760,235	Y10N	probably damaging	Het
Rfc1	G	A	5: 65,319,524	R4W	probably damaging	Het
Rgs19	A	T	2: 181,689,483	F119Y	probably damaging	Het
Safb	A	G	17: 56,605,821	H883R	probably benign	Het
Serpine1	G	A	5: 137,067,747	Q227*	probably null	Het
Slc25a13	A	G	6: 6,096,668		probably null	Het
Slc6a18	T	A	13: 73,664,189	T502S	possibly damaging	Het
Sox4	T	C	13: 28,952,648	D125G	probably damaging	Het
Stag3	C	T	5: 138,300,138	T731I	probably damaging	Het
Thada	G	T	17: 84,310,042	P1349T	probably damaging	Het
Tmem245	C	A	4: 56,937,964	V195F	probably benign	Het
Tnxb	A	G	17: 34,679,081	H901R	probably benign	Het
Trim39	A	T	17: 36,268,753	D103E	probably benign	Het
Ttn	A	T	2: 76,731,960	V28847E	probably damaging	Het
Tubb1	A	T	2: 174,455,691	D31V	possibly damaging	Het
Ush1g	A	G	11: 115,318,454	S305P	probably damaging	Het
Vmn1r191	A	T	13: 22,178,782	N267K	possibly damaging	Het
Vmn1r59	A	T	7: 5,454,039	Y241N	probably damaging	Het
Vmn2r49	T	C	7: 9,986,308	N419D	probably damaging	Het
Vps35	T	C	8: 85,278,994	D326G	possibly damaging	Het
Xdh	A	G	17: 73,892,751	S1187P	possibly damaging	Het
Xpc	A	C	6: 91,501,025		probably null	Het
Zfp273	T	C	13: 67,825,163	Y104H	probably damaging	Het

Other mutations in Dnah9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00696:Dnah9	APN	11	65841238	splice site	probably benign
IGL00805:Dnah9	APN	11	65881695	missense	probably benign	0.00
IGL00826:Dnah9	APN	11	65989942	missense	probably damaging	1.00
IGL01108:Dnah9	APN	11	65849980	missense	possibly damaging	0.93
IGL01152:Dnah9	APN	11	66072056	missense	probably damaging	1.00
IGL01353:Dnah9	APN	11	66080571	missense	probably damaging	1.00
IGL01364:Dnah9	APN	11	66155459	missense	probably damaging	1.00
IGL01479:Dnah9	APN	11	65955717	missense	probably benign	0.14
IGL01537:Dnah9	APN	11	65947680	missense	probably benign
IGL01565:Dnah9	APN	11	66033829	missense	possibly damaging	0.95
IGL01597:Dnah9	APN	11	66118830	missense	probably damaging	1.00
IGL01619:Dnah9	APN	11	65831615	nonsense	probably null
IGL01625:Dnah9	APN	11	66044645	missense	probably damaging	1.00
IGL01803:Dnah9	APN	11	66118829	missense	probably damaging	1.00
IGL01819:Dnah9	APN	11	66108126	missense	probably benign	0.33
IGL01896:Dnah9	APN	11	66130666	missense	possibly damaging	0.89
IGL01922:Dnah9	APN	11	66075034	splice site	probably benign
IGL01923:Dnah9	APN	11	66125235	splice site	probably benign
IGL02059:Dnah9	APN	11	66072958	missense	probably damaging	1.00
IGL02068:Dnah9	APN	11	66061045	missense	probably damaging	1.00
IGL02135:Dnah9	APN	11	66117492	missense	possibly damaging	0.63
IGL02146:Dnah9	APN	11	65927700	missense	probably damaging	1.00
IGL02264:Dnah9	APN	11	66080488	splice site	probably benign
IGL02325:Dnah9	APN	11	65834217	missense	probably damaging	1.00
IGL02426:Dnah9	APN	11	66125153	missense	probably benign
IGL02440:Dnah9	APN	11	65955246	missense	probably damaging	1.00
IGL02471:Dnah9	APN	11	65947618	nonsense	probably null
IGL02496:Dnah9	APN	11	66029363	missense	probably damaging	1.00
IGL02672:Dnah9	APN	11	65927601	missense	probably benign	0.02
IGL02718:Dnah9	APN	11	65886640	missense	probably damaging	0.99
IGL02832:Dnah9	APN	11	66040346	missense	probably damaging	1.00
IGL02851:Dnah9	APN	11	66037744	splice site	probably benign
IGL02859:Dnah9	APN	11	65881619	splice site	probably benign
IGL02864:Dnah9	APN	11	66061003	missense	probably damaging	1.00
IGL02954:Dnah9	APN	11	66118967	missense	probably damaging	1.00
IGL02987:Dnah9	APN	11	65855272	missense	probably damaging	0.98
IGL02987:Dnah9	APN	11	65841273	missense	probably benign	0.23
IGL03160:Dnah9	APN	11	66108054	missense	probably damaging	0.98
IGL03171:Dnah9	APN	11	65981241	missense	probably benign	0.13
IGL03180:Dnah9	APN	11	65886639	missense	probably damaging	0.99
IGL03388:Dnah9	APN	11	65947542	missense	probably damaging	1.00
anarchy	UTSW	11	65955248	missense	probably damaging	0.99
sacco	UTSW	11	66168079	missense	possibly damaging	0.82
Tweed	UTSW	11	66072072	missense	probably damaging	0.99
vanzetti	UTSW	11	65855372	nonsense	probably null
IGL02837:Dnah9	UTSW	11	65874196	missense	probably damaging	1.00
PIT4280001:Dnah9	UTSW	11	66005013	missense	probably benign	0.44
R0021:Dnah9	UTSW	11	65969979	missense	probably benign	0.36
R0021:Dnah9	UTSW	11	65969979	missense	probably benign	0.36
R0025:Dnah9	UTSW	11	65969955	splice site	probably benign
R0025:Dnah9	UTSW	11	65969955	splice site	probably benign
R0070:Dnah9	UTSW	11	66160040	missense	probably benign	0.10
R0164:Dnah9	UTSW	11	65918804	nonsense	probably null
R0164:Dnah9	UTSW	11	65918804	nonsense	probably null
R0180:Dnah9	UTSW	11	66147290	missense	probably damaging	1.00
R0195:Dnah9	UTSW	11	65895905	missense	probably benign	0.30
R0230:Dnah9	UTSW	11	65855315	missense	probably damaging	1.00
R0243:Dnah9	UTSW	11	65911852	missense	possibly damaging	0.91
R0279:Dnah9	UTSW	11	65911789	critical splice donor site	probably null
R0288:Dnah9	UTSW	11	66025134	critical splice donor site	probably null
R0309:Dnah9	UTSW	11	66026972	splice site	probably benign
R0356:Dnah9	UTSW	11	66130562	critical splice donor site	probably null
R0403:Dnah9	UTSW	11	66084789	missense	possibly damaging	0.90
R0413:Dnah9	UTSW	11	66108135	missense	probably damaging	1.00
R0448:Dnah9	UTSW	11	65918713	splice site	probably benign
R0496:Dnah9	UTSW	11	66075135	missense	probably null	1.00
R0557:Dnah9	UTSW	11	66084666	missense	probably damaging	1.00
R0584:Dnah9	UTSW	11	65990489	missense	probably damaging	1.00
R0598:Dnah9	UTSW	11	66118877	missense	probably benign	0.02
R0599:Dnah9	UTSW	11	65965689	missense	probably damaging	1.00
R0606:Dnah9	UTSW	11	65841333	missense	probably damaging	1.00
R0666:Dnah9	UTSW	11	66085458	missense	probably benign	0.01
R0715:Dnah9	UTSW	11	66081248	splice site	probably benign
R0726:Dnah9	UTSW	11	65965681	missense	probably damaging	1.00
R0737:Dnah9	UTSW	11	66107898	missense	probably damaging	1.00
R0763:Dnah9	UTSW	11	66155530	missense	probably benign	0.30
R0792:Dnah9	UTSW	11	65896001	missense	possibly damaging	0.84
R0829:Dnah9	UTSW	11	66005176	missense	probably benign	0.00
R0973:Dnah9	UTSW	11	66005837	splice site	probably null
R0974:Dnah9	UTSW	11	66005837	splice site	probably null
R1055:Dnah9	UTSW	11	66160011	missense	probably damaging	1.00
R1081:Dnah9	UTSW	11	66084877	missense	probably damaging	0.99
R1184:Dnah9	UTSW	11	66084612	critical splice donor site	probably null
R1225:Dnah9	UTSW	11	65871060	missense	possibly damaging	0.94
R1304:Dnah9	UTSW	11	65927588	missense	probably damaging	0.98
R1417:Dnah9	UTSW	11	65955747	missense	probably damaging	0.96
R1439:Dnah9	UTSW	11	65874132	missense	probably benign	0.22
R1447:Dnah9	UTSW	11	66108482	missense	possibly damaging	0.65
R1450:Dnah9	UTSW	11	65927786	missense	probably damaging	1.00
R1470:Dnah9	UTSW	11	65927822	missense	probably benign	0.11
R1470:Dnah9	UTSW	11	65927822	missense	probably benign	0.11
R1486:Dnah9	UTSW	11	65834272	missense	probably damaging	1.00
R1519:Dnah9	UTSW	11	65881761	missense	probably damaging	0.96
R1570:Dnah9	UTSW	11	66112330	missense	probably benign
R1617:Dnah9	UTSW	11	65895921	missense	probably damaging	1.00
R1623:Dnah9	UTSW	11	66037637	missense	probably damaging	1.00
R1626:Dnah9	UTSW	11	66085267	missense	probably benign	0.05
R1671:Dnah9	UTSW	11	65927963	missense	probably damaging	0.99
R1694:Dnah9	UTSW	11	65954824	nonsense	probably null
R1701:Dnah9	UTSW	11	65911924	missense	probably damaging	1.00
R1702:Dnah9	UTSW	11	66085195	missense	possibly damaging	0.72
R1708:Dnah9	UTSW	11	65915154	missense	probably benign	0.11
R1718:Dnah9	UTSW	11	66168079	missense	possibly damaging	0.82
R1729:Dnah9	UTSW	11	66085020	missense	possibly damaging	0.51
R1760:Dnah9	UTSW	11	65981222	missense	probably benign	0.31
R1784:Dnah9	UTSW	11	66085020	missense	possibly damaging	0.51
R1793:Dnah9	UTSW	11	66119594	critical splice donor site	probably null
R1801:Dnah9	UTSW	11	65955297	missense	probably damaging	0.99
R1827:Dnah9	UTSW	11	65850061	missense	probably damaging	0.97
R1836:Dnah9	UTSW	11	66118841	missense	probably benign	0.10
R1840:Dnah9	UTSW	11	65834198	nonsense	probably null
R1847:Dnah9	UTSW	11	65834386	missense	probably damaging	1.00
R1872:Dnah9	UTSW	11	66037490	missense	probably benign	0.16
R1929:Dnah9	UTSW	11	65976398	missense	probably benign	0.05
R1971:Dnah9	UTSW	11	65848371	missense	probably damaging	1.00
R2027:Dnah9	UTSW	11	65955338	missense	probably benign	0.11
R2049:Dnah9	UTSW	11	66044683	missense	probably damaging	1.00
R2064:Dnah9	UTSW	11	66145435	missense	probably benign	0.31
R2104:Dnah9	UTSW	11	66061124	missense	probably damaging	1.00
R2109:Dnah9	UTSW	11	66037585	missense	probably damaging	1.00
R2160:Dnah9	UTSW	11	66117483	missense	probably damaging	1.00
R2172:Dnah9	UTSW	11	66072779	missense	probably damaging	1.00
R2198:Dnah9	UTSW	11	65859499	missense	possibly damaging	0.50
R2271:Dnah9	UTSW	11	66112362	missense	probably benign	0.37
R2272:Dnah9	UTSW	11	66112362	missense	probably benign	0.37
R2396:Dnah9	UTSW	11	66085158	missense	probably benign	0.01
R2398:Dnah9	UTSW	11	65915203	missense	probably damaging	1.00
R2418:Dnah9	UTSW	11	66095415	nonsense	probably null
R2419:Dnah9	UTSW	11	66095415	nonsense	probably null
R2510:Dnah9	UTSW	11	66005169	missense	probably damaging	1.00
R2680:Dnah9	UTSW	11	66033925	missense	probably benign	0.00
R2875:Dnah9	UTSW	11	66168461	missense	possibly damaging	0.89
R2979:Dnah9	UTSW	11	66117588	missense	possibly damaging	0.89
R3236:Dnah9	UTSW	11	65954989	missense	probably benign	0.11
R3237:Dnah9	UTSW	11	65954989	missense	probably benign	0.11
R3433:Dnah9	UTSW	11	66075112	missense	possibly damaging	0.85
R3737:Dnah9	UTSW	11	66156908	nonsense	probably null
R3820:Dnah9	UTSW	11	65851003	critical splice donor site	probably null
R3821:Dnah9	UTSW	11	65851003	critical splice donor site	probably null
R3822:Dnah9	UTSW	11	65851003	critical splice donor site	probably null
R3861:Dnah9	UTSW	11	66052994	splice site	probably benign
R3918:Dnah9	UTSW	11	65870974	missense	possibly damaging	0.54
R4011:Dnah9	UTSW	11	65834464	missense	probably damaging	0.98
R4044:Dnah9	UTSW	11	66133635	missense	probably benign	0.03
R4072:Dnah9	UTSW	11	66084904	missense	probably benign	0.00
R4076:Dnah9	UTSW	11	66084904	missense	probably benign	0.00
R4097:Dnah9	UTSW	11	65990459	missense	probably damaging	1.00
R4409:Dnah9	UTSW	11	66085477	missense	possibly damaging	0.51
R4410:Dnah9	UTSW	11	66085477	missense	possibly damaging	0.51
R4417:Dnah9	UTSW	11	65981214	missense	possibly damaging	0.75
R4420:Dnah9	UTSW	11	66118749	missense	probably benign	0.00
R4434:Dnah9	UTSW	11	66108075	missense	possibly damaging	0.67
R4451:Dnah9	UTSW	11	65881641	missense	probably benign	0.07
R4452:Dnah9	UTSW	11	66027082	missense	probably damaging	0.96
R4454:Dnah9	UTSW	11	66147389	missense	probably damaging	0.96
R4551:Dnah9	UTSW	11	65841366	missense	probably damaging	1.00
R4552:Dnah9	UTSW	11	65841366	missense	probably damaging	1.00
R4590:Dnah9	UTSW	11	66040392	missense	probably damaging	1.00
R4595:Dnah9	UTSW	11	66168152	missense	probably benign
R4655:Dnah9	UTSW	11	65955732	missense	probably benign	0.00
R4667:Dnah9	UTSW	11	66155531	missense	probably benign
R4718:Dnah9	UTSW	11	66085473	missense	probably benign
R4720:Dnah9	UTSW	11	66076358	missense	probably damaging	1.00
R4734:Dnah9	UTSW	11	65834115	missense	probably damaging	1.00
R4749:Dnah9	UTSW	11	65834115	missense	probably damaging	1.00
R4765:Dnah9	UTSW	11	65927726	missense	probably damaging	1.00
R4905:Dnah9	UTSW	11	65874124	nonsense	probably null
R4963:Dnah9	UTSW	11	66084611	splice site	probably null
R5074:Dnah9	UTSW	11	65850040	missense	probably damaging	1.00
R5230:Dnah9	UTSW	11	66084666	missense	probably damaging	0.99
R5262:Dnah9	UTSW	11	66112333	missense	probably benign	0.34
R5364:Dnah9	UTSW	11	65881696	missense	possibly damaging	0.93
R5370:Dnah9	UTSW	11	66029354	missense	probably damaging	1.00
R5386:Dnah9	UTSW	11	66029356	missense	probably damaging	1.00
R5389:Dnah9	UTSW	11	66095314	nonsense	probably null
R5541:Dnah9	UTSW	11	66145336	missense	probably damaging	1.00
R5560:Dnah9	UTSW	11	65881740	missense	probably benign	0.00
R5576:Dnah9	UTSW	11	65834096	splice site	probably null
R5648:Dnah9	UTSW	11	65927755	missense	probably benign	0.00
R5653:Dnah9	UTSW	11	65849980	missense	probably damaging	0.99
R5713:Dnah9	UTSW	11	66025223	missense	possibly damaging	0.92
R5763:Dnah9	UTSW	11	65955239	missense	probably damaging	1.00
R5825:Dnah9	UTSW	11	66126601	missense	probably benign	0.01
R5831:Dnah9	UTSW	11	66108121	missense	probably benign	0.00
R5847:Dnah9	UTSW	11	66095240	frame shift	probably null
R5870:Dnah9	UTSW	11	66085210	missense	probably benign	0.01
R5902:Dnah9	UTSW	11	66025187	missense	probably benign	0.08
R5918:Dnah9	UTSW	11	65834199	missense	probably damaging	1.00
R5979:Dnah9	UTSW	11	65834481	missense	probably damaging	1.00
R6065:Dnah9	UTSW	11	65855338	missense	probably benign	0.05
R6065:Dnah9	UTSW	11	66145397	missense	possibly damaging	0.65
R6086:Dnah9	UTSW	11	65989915	missense	probably damaging	0.99
R6086:Dnah9	UTSW	11	66085174	missense	probably benign
R6102:Dnah9	UTSW	11	65990516	missense	probably damaging	0.97
R6120:Dnah9	UTSW	11	66147399	missense	probably benign
R6154:Dnah9	UTSW	11	65855338	missense	probably benign	0.00
R6262:Dnah9	UTSW	11	65881805	splice site	probably null
R6265:Dnah9	UTSW	11	66168094	missense	probably benign	0.04
R6290:Dnah9	UTSW	11	65841375	missense	probably damaging	1.00
R6345:Dnah9	UTSW	11	66037693	missense	probably damaging	0.97
R6357:Dnah9	UTSW	11	65874196	missense	probably damaging	1.00
R6534:Dnah9	UTSW	11	65955248	missense	probably damaging	0.99
R6574:Dnah9	UTSW	11	66168281	missense	probably benign	0.37
R6582:Dnah9	UTSW	11	66061097	missense	probably damaging	1.00
R6700:Dnah9	UTSW	11	65955366	missense	probably damaging	1.00
R6800:Dnah9	UTSW	11	66072739	critical splice donor site	probably null
R6812:Dnah9	UTSW	11	65981329	missense	probably damaging	0.99
R6931:Dnah9	UTSW	11	66117626	missense	possibly damaging	0.63
R6944:Dnah9	UTSW	11	66085149	missense	possibly damaging	0.91
R6958:Dnah9	UTSW	11	66076341	missense	probably damaging	1.00
R6977:Dnah9	UTSW	11	66107909	missense	probably benign	0.37
R7021:Dnah9	UTSW	11	65981231	missense	probably benign
R7161:Dnah9	UTSW	11	65855372	nonsense	probably null
R7175:Dnah9	UTSW	11	66133637	missense	probably benign	0.03
R7199:Dnah9	UTSW	11	66118944	missense	probably benign	0.04
R7231:Dnah9	UTSW	11	65965647	missense	probably damaging	1.00
R7284:Dnah9	UTSW	11	65990476	missense	probably damaging	0.99
R7314:Dnah9	UTSW	11	65989851	missense	probably benign	0.00
R7350:Dnah9	UTSW	11	66080578	missense	probably damaging	1.00
R7420:Dnah9	UTSW	11	66117407	critical splice donor site	probably null
R7427:Dnah9	UTSW	11	65955219	missense	probably benign
R7477:Dnah9	UTSW	11	65992731	missense	probably damaging	0.98
R7515:Dnah9	UTSW	11	65841414	missense	probably benign	0.01
R7521:Dnah9	UTSW	11	65989837	missense	probably damaging	0.98
R7573:Dnah9	UTSW	11	66125215	missense	probably benign	0.43
R7659:Dnah9	UTSW	11	65989780	missense	probably damaging	0.99
R7707:Dnah9	UTSW	11	66118958	missense	probably damaging	1.00
R7749:Dnah9	UTSW	11	65911830	missense	probably damaging	1.00
R7792:Dnah9	UTSW	11	65850013	missense	probably damaging	1.00
R7808:Dnah9	UTSW	11	66005805	nonsense	probably null
R7814:Dnah9	UTSW	11	66005660	missense	probably damaging	1.00
R7818:Dnah9	UTSW	11	66025211	missense	possibly damaging	0.64
R7890:Dnah9	UTSW	11	66072072	missense	probably damaging	0.99
R7976:Dnah9	UTSW	11	65841401	missense	possibly damaging	0.91
R8121:Dnah9	UTSW	11	66017375	missense	probably benign	0.02
R8232:Dnah9	UTSW	11	65855323	missense	possibly damaging	0.91
R8311:Dnah9	UTSW	11	65989818	missense	probably benign	0.00
R8326:Dnah9	UTSW	11	66117626	missense	probably benign	0.01
R8338:Dnah9	UTSW	11	65841241	critical splice donor site	probably null
R8356:Dnah9	UTSW	11	66156938	missense	probably damaging	0.99
R8456:Dnah9	UTSW	11	66156938	missense	probably damaging	0.99
R8468:Dnah9	UTSW	11	65831730	missense	probably benign	0.00
R8721:Dnah9	UTSW	11	66095298	missense	probably damaging	1.00
R8747:Dnah9	UTSW	11	65927990	missense	possibly damaging	0.69
R8798:Dnah9	UTSW	11	65905231	missense	probably damaging	0.99
R8806:Dnah9	UTSW	11	65859483	missense	probably damaging	1.00
R8826:Dnah9	UTSW	11	65849916	missense	probably benign	0.13
R8837:Dnah9	UTSW	11	65855234	missense	possibly damaging	0.72
R8886:Dnah9	UTSW	11	66053014	missense	probably damaging	1.00
R8887:Dnah9	UTSW	11	65855384	missense	probably benign	0.01
R8921:Dnah9	UTSW	11	65911921	missense	probably benign
R8933:Dnah9	UTSW	11	65855252	missense	possibly damaging	0.88
R8949:Dnah9	UTSW	11	66168400	missense	possibly damaging	0.91
R8967:Dnah9	UTSW	11	66125112	critical splice donor site	probably null
R8979:Dnah9	UTSW	11	66005152	missense	probably benign
R8991:Dnah9	UTSW	11	65886680	missense	probably damaging	0.96
R9016:Dnah9	UTSW	11	66108030	missense	probably damaging	0.99
R9025:Dnah9	UTSW	11	66005825	missense	probably damaging	1.00
R9043:Dnah9	UTSW	11	65954854	missense
R9047:Dnah9	UTSW	11	66072099	missense	possibly damaging	0.89
R9076:Dnah9	UTSW	11	66117638	missense	probably benign	0.21
R9113:Dnah9	UTSW	11	65989887	missense	probably damaging	1.00
R9152:Dnah9	UTSW	11	66130631	missense	probably damaging	1.00
R9187:Dnah9	UTSW	11	66005146	missense	probably benign
R9198:Dnah9	UTSW	11	65955744	missense	probably benign	0.02
R9203:Dnah9	UTSW	11	65855287	missense	possibly damaging	0.58
R9234:Dnah9	UTSW	11	66033925	missense	possibly damaging	0.68
R9245:Dnah9	UTSW	11	65895905	missense	probably benign	0.30
R9265:Dnah9	UTSW	11	65841255	missense	probably benign	0.01
R9307:Dnah9	UTSW	11	66085474	missense	probably benign	0.14
R9336:Dnah9	UTSW	11	65870949	missense	probably damaging	1.00
R9386:Dnah9	UTSW	11	65947542	missense	probably damaging	1.00
R9498:Dnah9	UTSW	11	65848373	missense	probably damaging	0.99
R9508:Dnah9	UTSW	11	65834263	missense	probably damaging	1.00
R9524:Dnah9	UTSW	11	66085483	missense	possibly damaging	0.92
R9577:Dnah9	UTSW	11	65976521	missense	probably benign	0.00
R9583:Dnah9	UTSW	11	65965681	missense	probably damaging	1.00
R9587:Dnah9	UTSW	11	66108391	missense	probably null	0.92
R9612:Dnah9	UTSW	11	65927649	missense	probably benign	0.00
R9748:Dnah9	UTSW	11	66085464	missense	possibly damaging	0.51
R9749:Dnah9	UTSW	11	66095376	missense	probably damaging	1.00
R9759:Dnah9	UTSW	11	66075118	missense	probably null	0.93
R9784:Dnah9	UTSW	11	66085134	missense	probably damaging	0.99
V3553:Dnah9	UTSW	11	65970076	missense	probably damaging	1.00
X0027:Dnah9	UTSW	11	66085479	missense	probably benign	0.07
X0028:Dnah9	UTSW	11	65990452	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	65895972	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	65927853	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	65970084	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	66037474	missense	probably damaging	1.00
Z1176:Dnah9	UTSW	11	66072835	missense	probably damaging	1.00
Z1177:Dnah9	UTSW	11	66126650	missense	probably damaging	1.00
Z1186:Dnah9	UTSW	11	66085174	missense	probably benign
Z1186:Dnah9	UTSW	11	66147381	missense	probably benign
Z1187:Dnah9	UTSW	11	66085174	missense	probably benign
Z1187:Dnah9	UTSW	11	66147381	missense	probably benign
Z1188:Dnah9	UTSW	11	66085174	missense	probably benign
Z1188:Dnah9	UTSW	11	66147381	missense	probably benign
Z1189:Dnah9	UTSW	11	66085174	missense	probably benign
Z1189:Dnah9	UTSW	11	66147381	missense	probably benign
Z1190:Dnah9	UTSW	11	66085174	missense	probably benign
Z1190:Dnah9	UTSW	11	66147381	missense	probably benign
Z1191:Dnah9	UTSW	11	66085174	missense	probably benign
Z1191:Dnah9	UTSW	11	66147381	missense	probably benign
Z1192:Dnah9	UTSW	11	66085174	missense	probably benign
Z1192:Dnah9	UTSW	11	66147381	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTTAGTCACCCTACCACTACTGAAG -3'
(R):5'- GTGCTGAGTAGTAACTGTGCC -3'

Sequencing Primer
(F):5'- CCTACCACTACTGAAGTTATTTGCAG -3'
(R):5'- AACTGTGCCTGGTATGTGAAGTAAG -3'

Posted On

2014-08-25