Incidental Mutation 'R2010:Muc2'
ID 219492
Institutional Source Beutler Lab
Gene Symbol Muc2
Ensembl Gene ENSMUSG00000025515
Gene Name mucin 2
Synonyms 2010015E03Rik
MMRRC Submission 040019-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.099) question?
Stock # R2010 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 141276583-141308428 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 141287444 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 208 (T208S)
Ref Sequence ENSEMBL: ENSMUSP00000140855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167366] [ENSMUST00000179227] [ENSMUST00000185406] [ENSMUST00000185823]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000167366
AA Change: T207S

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128250
Gene: ENSMUSG00000025515
AA Change: T207S

DomainStartEndE-ValueType
Pfam:VWD 3 72 2.3e-14 PFAM
C8 107 181 1.82e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179227
SMART Domains Protein: ENSMUSP00000136692
Gene: ENSMUSG00000025515

DomainStartEndE-ValueType
C8 11 85 1.61e-32 SMART
Blast:VWD 102 128 5e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000185406
SMART Domains Protein: ENSMUSP00000141040
Gene: ENSMUSG00000025515

DomainStartEndE-ValueType
low complexity region 5 18 N/A INTRINSIC
VWD 20 183 1.5e-40 SMART
C8 216 290 3.9e-15 SMART
Pfam:TIL 293 349 5.4e-10 PFAM
VWC 351 411 7e-4 SMART
VWD 378 542 8.8e-44 SMART
C8 579 653 1.2e-36 SMART
SCOP:d1coua_ 654 728 4e-8 SMART
VWC_def 820 865 1.3e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185823
AA Change: T208S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140855
Gene: ENSMUSG00000025515
AA Change: T208S

DomainStartEndE-ValueType
Pfam:VWD 3 73 5.6e-14 PFAM
C8 108 182 1.4e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187789
Predicted Effect probably benign
Transcript: ENSMUST00000191587
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik G A 3: 36,535,955 (GRCm39) G74S unknown Het
Aimp1 A T 3: 132,373,253 (GRCm39) L229Q probably benign Het
Arhgef6 T C X: 56,344,865 (GRCm39) T52A possibly damaging Het
Aste1 C A 9: 105,280,701 (GRCm39) H25Q probably damaging Het
Atp13a1 G A 8: 70,244,010 (GRCm39) G36R possibly damaging Het
Bahcc1 T C 11: 120,163,604 (GRCm39) V634A probably damaging Het
Bltp1 T G 3: 36,982,700 (GRCm39) N788K probably benign Het
C1s1 A T 6: 124,514,353 (GRCm39) Y168N probably damaging Het
Camsap2 T C 1: 136,202,606 (GRCm39) S612G probably damaging Het
Cdh23 C A 10: 60,150,006 (GRCm39) R2611L probably damaging Het
Cfap20dc A T 14: 8,511,021 (GRCm38) F464L probably damaging Het
Cilp2 A G 8: 70,334,344 (GRCm39) Y885H probably damaging Het
Dhrs3 C T 4: 144,653,758 (GRCm39) T227I possibly damaging Het
Dnah2 A T 11: 69,349,184 (GRCm39) probably null Het
Dnah3 T G 7: 119,694,400 (GRCm39) M1L probably benign Het
Ehbp1l1 A G 19: 5,769,311 (GRCm39) I664T probably benign Het
Eif4e C T 3: 138,261,219 (GRCm39) T171I probably benign Het
Elfn1 C T 5: 139,959,071 (GRCm39) R692W probably damaging Het
Eps8l3 T A 3: 107,786,688 (GRCm39) M1K probably null Het
Evi5 C A 5: 107,961,411 (GRCm39) probably null Het
Fancd2 A T 6: 113,570,252 (GRCm39) D1401V probably damaging Het
Fat2 G A 11: 55,144,653 (GRCm39) R4074C probably damaging Het
Fkbp4 A T 6: 128,412,765 (GRCm39) V55E probably benign Het
Fnip1 A G 11: 54,373,329 (GRCm39) D180G probably damaging Het
Galc A G 12: 98,220,489 (GRCm39) F126S possibly damaging Het
Gdf7 C T 12: 8,351,729 (GRCm39) V69M unknown Het
Glis2 A G 16: 4,426,575 (GRCm39) E22G probably damaging Het
H2bc3 G A 13: 23,931,111 (GRCm39) V112M possibly damaging Het
Hps4 T A 5: 112,517,342 (GRCm39) V243E probably damaging Het
Ighe T A 12: 113,235,108 (GRCm39) I351F unknown Het
Irak4 A T 15: 94,449,687 (GRCm39) R55S probably damaging Het
Itpr2 G A 6: 146,129,022 (GRCm39) probably null Het
Katnip A G 7: 125,472,128 (GRCm39) I1544M possibly damaging Het
Kirrel3 T C 9: 34,850,494 (GRCm39) Y41H probably damaging Het
Krr1 A G 10: 111,811,474 (GRCm39) E56G possibly damaging Het
Lgi1 G A 19: 38,289,683 (GRCm39) V250I probably damaging Het
Lipf A G 19: 33,950,946 (GRCm39) N306D probably benign Het
Lman2l C T 1: 36,484,262 (GRCm39) W18* probably null Het
Lztfl1 T A 9: 123,531,251 (GRCm39) N239I possibly damaging Het
Mief1 T C 15: 80,132,126 (GRCm39) S66P possibly damaging Het
Mmp8 C A 9: 7,567,535 (GRCm39) S465* probably null Het
Myh8 A T 11: 67,187,990 (GRCm39) K921* probably null Het
Myh9 T C 15: 77,656,147 (GRCm39) E1121G probably benign Het
Nbn T C 4: 15,969,393 (GRCm39) S213P probably damaging Het
Nol10 A G 12: 17,466,102 (GRCm39) E499G probably benign Het
Nxn T C 11: 76,289,627 (GRCm39) E87G probably damaging Het
Or14c40 A G 7: 86,313,811 (GRCm39) T314A probably benign Het
Or51f2 T A 7: 102,526,892 (GRCm39) C188* probably null Het
Or8g23 T C 9: 38,971,395 (GRCm39) H189R probably benign Het
Pds5b CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 5: 150,698,819 (GRCm39) probably benign Het
Pigk A G 3: 152,472,151 (GRCm39) I354M probably damaging Het
Pigl T A 11: 62,349,508 (GRCm39) C75S probably damaging Het
Pm20d1 T A 1: 131,739,852 (GRCm39) I400N probably benign Het
Prkg2 T A 5: 99,172,664 (GRCm39) H17L probably benign Het
Psmd1 T A 1: 86,003,719 (GRCm39) L168Q probably damaging Het
Rab3gap2 A T 1: 185,010,478 (GRCm39) H1136L possibly damaging Het
Rb1 T C 14: 73,532,433 (GRCm39) T134A probably benign Het
Rims1 T C 1: 22,367,220 (GRCm39) E1024G probably damaging Het
Rrp12 A G 19: 41,861,376 (GRCm39) V977A probably benign Het
Rusc2 C T 4: 43,415,212 (GRCm39) P173S probably benign Het
Selenov A T 7: 27,987,447 (GRCm39) D310E probably damaging Het
Serpina3f T A 12: 104,183,582 (GRCm39) L148Q probably damaging Het
Slc10a1 C T 12: 81,007,221 (GRCm39) V187I probably benign Het
Spsb2 A G 6: 124,787,339 (GRCm39) K258E probably damaging Het
Tas2r105 A C 6: 131,664,365 (GRCm39) V21G probably benign Het
Tmem229b-ps T A 10: 53,351,295 (GRCm39) noncoding transcript Het
Tnrc6a C G 7: 122,770,269 (GRCm39) H686Q probably benign Het
Trpc2 T A 7: 101,743,780 (GRCm39) F715L probably benign Het
Ube2t T A 1: 134,897,036 (GRCm39) I56N probably benign Het
Ubr4 T C 4: 139,207,963 (GRCm39) Y4915H possibly damaging Het
Usp32 T A 11: 84,930,830 (GRCm39) E533D probably damaging Het
Vipr2 T G 12: 116,086,430 (GRCm39) probably null Het
Vmn1r15 A G 6: 57,235,269 (GRCm39) T46A probably benign Het
Vmn1r203 T G 13: 22,708,617 (GRCm39) S133A possibly damaging Het
Vmn1r215 T G 13: 23,260,378 (GRCm39) N139K probably damaging Het
Vmn1r232 C T 17: 21,133,601 (GRCm39) R333H probably benign Het
Wdr20rt C A 12: 65,273,988 (GRCm39) H311N possibly damaging Het
Zranb1 T C 7: 132,568,425 (GRCm39) probably null Het
Other mutations in Muc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
Eeyore APN 7 141,693,356 (GRCm38) missense probably benign 0.35
kenny APN 7 0 () nonsense
Winnie APN 7 141,286,029 (GRCm39) missense probably damaging 1.00
IGL01303:Muc2 APN 7 141,306,132 (GRCm39) missense probably benign
IGL01482:Muc2 APN 7 141,307,797 (GRCm39) missense probably damaging 0.96
IGL01875:Muc2 APN 7 141,306,477 (GRCm39) missense probably damaging 0.99
IGL02088:Muc2 APN 7 141,305,241 (GRCm39) missense probably damaging 1.00
IGL02415:Muc2 APN 7 141,305,609 (GRCm39) nonsense probably null
IGL02548:Muc2 APN 7 141,305,594 (GRCm39) missense probably damaging 1.00
IGL02836:Muc2 APN 7 141,300,450 (GRCm39) unclassified probably benign
IGL03196:Muc2 APN 7 141,301,367 (GRCm39) missense probably damaging 0.97
Muskatenwein UTSW 7 141,307,176 (GRCm39) missense unknown
nomoco UTSW 7 141,307,456 (GRCm39) missense probably damaging 1.00
Schlendrian UTSW 7 141,281,925 (GRCm39) missense probably damaging 1.00
Seco UTSW 7 141,284,976 (GRCm39) missense probably damaging 1.00
BB001:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
BB011:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
E0370:Muc2 UTSW 7 141,282,598 (GRCm39) missense probably damaging 1.00
R0127:Muc2 UTSW 7 141,302,691 (GRCm39) missense probably benign 0.00
R0179:Muc2 UTSW 7 141,302,708 (GRCm39) missense probably damaging 1.00
R0201:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R0299:Muc2 UTSW 7 141,306,466 (GRCm39) missense probably damaging 1.00
R0547:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R0699:Muc2 UTSW 7 141,306,037 (GRCm39) missense probably damaging 1.00
R0900:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R1348:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R1466:Muc2 UTSW 7 141,302,711 (GRCm39) missense probably damaging 1.00
R1466:Muc2 UTSW 7 141,302,711 (GRCm39) missense probably damaging 1.00
R1625:Muc2 UTSW 7 141,283,405 (GRCm39) missense probably damaging 1.00
R2149:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R2163:Muc2 UTSW 7 141,699,185 (GRCm38) frame shift probably null
R3008:Muc2 UTSW 7 141,281,347 (GRCm39) missense possibly damaging 0.93
R3110:Muc2 UTSW 7 141,299,225 (GRCm39) unclassified probably benign
R3112:Muc2 UTSW 7 141,299,225 (GRCm39) unclassified probably benign
R3424:Muc2 UTSW 7 141,279,595 (GRCm39) missense probably damaging 0.99
R3786:Muc2 UTSW 7 141,283,590 (GRCm39) missense probably benign 0.01
R3854:Muc2 UTSW 7 141,308,081 (GRCm39) missense probably damaging 1.00
R3964:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3965:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3966:Muc2 UTSW 7 141,286,233 (GRCm39) missense probably benign 0.17
R3973:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R3974:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R3976:Muc2 UTSW 7 141,300,541 (GRCm39) unclassified probably benign
R4327:Muc2 UTSW 7 141,281,577 (GRCm39) missense probably damaging 0.96
R4694:Muc2 UTSW 7 141,306,082 (GRCm39) missense probably damaging 1.00
R4764:Muc2 UTSW 7 141,299,345 (GRCm39) missense possibly damaging 0.88
R4769:Muc2 UTSW 7 141,286,260 (GRCm39) critical splice donor site probably null
R4798:Muc2 UTSW 7 141,307,877 (GRCm39) missense probably benign 0.01
R4900:Muc2 UTSW 7 141,303,280 (GRCm39) missense probably benign 0.32
R5383:Muc2 UTSW 7 141,307,456 (GRCm39) missense probably damaging 1.00
R5489:Muc2 UTSW 7 141,305,169 (GRCm39) missense probably benign 0.00
R5615:Muc2 UTSW 7 141,277,446 (GRCm39) missense probably damaging 1.00
R5856:Muc2 UTSW 7 141,299,381 (GRCm39) unclassified probably benign
R5919:Muc2 UTSW 7 141,281,171 (GRCm39) missense probably damaging 0.97
R5953:Muc2 UTSW 7 141,287,951 (GRCm39) missense probably damaging 0.96
R5979:Muc2 UTSW 7 141,305,143 (GRCm39) missense probably damaging 0.99
R5979:Muc2 UTSW 7 141,283,493 (GRCm39) splice site probably null
R6175:Muc2 UTSW 7 141,282,875 (GRCm39) missense probably damaging 1.00
R6213:Muc2 UTSW 7 141,305,151 (GRCm39) missense probably damaging 1.00
R6281:Muc2 UTSW 7 141,306,140 (GRCm39) missense probably damaging 1.00
R6321:Muc2 UTSW 7 141,287,397 (GRCm39) missense probably benign 0.28
R6390:Muc2 UTSW 7 141,305,883 (GRCm39) missense probably damaging 0.97
R6485:Muc2 UTSW 7 141,300,473 (GRCm39) unclassified probably benign
R6582:Muc2 UTSW 7 141,282,941 (GRCm39) missense probably benign 0.00
R6683:Muc2 UTSW 7 141,305,214 (GRCm39) missense probably benign 0.38
R6896:Muc2 UTSW 7 141,306,432 (GRCm39) missense possibly damaging 0.48
R6906:Muc2 UTSW 7 141,284,976 (GRCm39) missense probably damaging 1.00
R6924:Muc2 UTSW 7 141,284,077 (GRCm39) missense possibly damaging 0.87
R7040:Muc2 UTSW 7 141,305,194 (GRCm39) missense unknown
R7222:Muc2 UTSW 7 141,290,758 (GRCm39) missense
R7251:Muc2 UTSW 7 141,278,965 (GRCm39) missense possibly damaging 0.91
R7282:Muc2 UTSW 7 141,306,481 (GRCm39) missense
R7315:Muc2 UTSW 7 141,276,645 (GRCm39) missense probably damaging 0.99
R7421:Muc2 UTSW 7 141,301,863 (GRCm39) missense
R7556:Muc2 UTSW 7 141,307,439 (GRCm39) missense
R7651:Muc2 UTSW 7 141,290,750 (GRCm39) missense
R7710:Muc2 UTSW 7 141,287,452 (GRCm39) missense possibly damaging 0.92
R7776:Muc2 UTSW 7 141,290,942 (GRCm39) missense
R7813:Muc2 UTSW 7 141,282,543 (GRCm39) splice site probably null
R7843:Muc2 UTSW 7 141,281,662 (GRCm39) missense probably benign 0.03
R7869:Muc2 UTSW 7 141,303,471 (GRCm39) missense
R7924:Muc2 UTSW 7 141,281,631 (GRCm39) missense probably damaging 1.00
R7993:Muc2 UTSW 7 141,308,173 (GRCm39) missense
R8053:Muc2 UTSW 7 141,284,575 (GRCm39) missense probably benign 0.01
R8068:Muc2 UTSW 7 141,298,422 (GRCm39) missense
R8099:Muc2 UTSW 7 141,299,175 (GRCm39) splice site probably null
R8192:Muc2 UTSW 7 141,305,215 (GRCm39) missense
R8194:Muc2 UTSW 7 141,290,801 (GRCm39) missense
R8545:Muc2 UTSW 7 141,306,130 (GRCm39) missense unknown
R8701:Muc2 UTSW 7 141,281,850 (GRCm39) missense probably damaging 1.00
R8883:Muc2 UTSW 7 141,287,469 (GRCm39) missense probably damaging 0.98
R8894:Muc2 UTSW 7 141,280,758 (GRCm39) missense probably damaging 1.00
R8905:Muc2 UTSW 7 141,279,643 (GRCm39) missense probably benign 0.00
R9024:Muc2 UTSW 7 141,287,936 (GRCm39) missense probably damaging 0.98
R9032:Muc2 UTSW 7 141,287,058 (GRCm39) missense probably damaging 1.00
R9085:Muc2 UTSW 7 141,287,058 (GRCm39) missense probably damaging 1.00
R9091:Muc2 UTSW 7 141,290,816 (GRCm39) missense
R9104:Muc2 UTSW 7 141,286,224 (GRCm39) missense probably damaging 1.00
R9114:Muc2 UTSW 7 141,287,983 (GRCm39) nonsense probably null
R9270:Muc2 UTSW 7 141,290,816 (GRCm39) missense
R9297:Muc2 UTSW 7 141,302,759 (GRCm39) missense
R9325:Muc2 UTSW 7 141,298,559 (GRCm39) missense
R9354:Muc2 UTSW 7 141,307,157 (GRCm39) missense
R9386:Muc2 UTSW 7 141,279,389 (GRCm39) missense probably damaging 1.00
R9529:Muc2 UTSW 7 141,287,453 (GRCm39) missense possibly damaging 0.55
R9550:Muc2 UTSW 7 141,308,242 (GRCm39) missense probably damaging 1.00
R9583:Muc2 UTSW 7 141,300,559 (GRCm39) missense
R9607:Muc2 UTSW 7 141,305,190 (GRCm39) missense
R9646:Muc2 UTSW 7 141,276,643 (GRCm39) missense probably benign
R9651:Muc2 UTSW 7 141,288,014 (GRCm39) missense probably damaging 0.99
R9774:Muc2 UTSW 7 141,285,811 (GRCm39) missense probably benign
R9784:Muc2 UTSW 7 141,280,785 (GRCm39) nonsense probably null
Z1176:Muc2 UTSW 7 141,300,451 (GRCm39) missense
Z1177:Muc2 UTSW 7 141,298,531 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- CGTCCTTTCTTGAGCCATAGTG -3'
(R):5'- TAAGATTCTCAACCCTTGGGCC -3'

Sequencing Primer
(F):5'- TCTTGAGCCATAGTGAGACTCGC -3'
(R):5'- AACCCTTGGGCCTCTCTCAAAG -3'
Posted On 2014-08-25