Mutagenetix > Incidental Mutation

Incidental Mutation 'R1969:Dnah17'

219509

Institutional Source

Beutler Lab

Gene Symbol

Dnah17

Ensembl Gene

ENSMUSG00000033987

Gene Name

dynein, axonemal, heavy chain 17

Synonyms

LOC382552, Dnahcl1, 2810003K23Rik, Dnahc17

MMRRC Submission

039982-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1969 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

118021723-118130634 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 118104535 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Glutamic Acid at position 996 (Q996E)

Ref Sequence

ENSEMBL: ENSMUSP00000120542 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084803] [ENSMUST00000106308] [ENSMUST00000132685]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000084803
AA Change: Q996E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000081864
Gene: ENSMUSG00000033987
AA Change: Q996E

Domain	Start	End	E-Value	Type
Pfam:DHC_N1	183	766	8.5e-142	PFAM
low complexity region	1015	1028	N/A	INTRINSIC
Pfam:DHC_N2	1260	1673	5.8e-135	PFAM
Pfam:AAA_6	1793	2023	6e-161	PFAM
low complexity region	2092	2104	N/A	INTRINSIC
Pfam:AAA_5	2107	2243	7.8e-13	PFAM
Pfam:AAA_7	2400	2671	1.1e-171	PFAM
Pfam:AAA_8	2748	3015	4.9e-166	PFAM
Pfam:MT	3027	3370	3.4e-214	PFAM
Pfam:AAA_9	3388	3615	2.4e-144	PFAM
Pfam:Dynein_heavy	3742	4452	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106308
AA Change: Q996E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000101915
Gene: ENSMUSG00000033987
AA Change: Q996E

Domain	Start	End	E-Value	Type
Pfam:DHC_N1	184	764	1.7e-152	PFAM
low complexity region	1015	1028	N/A	INTRINSIC
Pfam:DHC_N2	1262	1671	4.1e-132	PFAM
Pfam:AAA_6	1793	2023	7e-149	PFAM
low complexity region	2092	2104	N/A	INTRINSIC
Pfam:AAA_5	2107	2243	2.5e-11	PFAM
Pfam:AAA_7	2400	2671	4.4e-169	PFAM
Pfam:AAA_8	2748	3015	7.1e-163	PFAM
Pfam:MT	3027	3370	1.1e-210	PFAM
Pfam:AAA_9	3392	3614	1e-84	PFAM
Pfam:Dynein_heavy	3748	4479	3.5e-230	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000132685
AA Change: Q996E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000120542
Gene: ENSMUSG00000033987
AA Change: Q996E

Domain	Start	End	E-Value	Type
Pfam:DHC_N2	279	688	3.1e-132	PFAM
Pfam:AAA_6	811	1041	5.3e-149	PFAM
low complexity region	1110	1122	N/A	INTRINSIC
Blast:AAA	1123	1354	1e-104	BLAST
Pfam:AAA_7	1452	1671	8.9e-134	PFAM
Pfam:AAA_8	1763	2030	5.4e-163	PFAM
Pfam:MT	2042	2168	6.8e-52	PFAM
Pfam:MT	2163	2412	8.2e-149	PFAM
Pfam:AAA_9	2434	2656	7.9e-85	PFAM
Pfam:Dynein_heavy	2790	3457	2.6e-209	PFAM
Pfam:Dynein_heavy	3460	3569	4.6e-17	PFAM

Meta Mutation Damage Score

0.1051

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. DNAH17 is a heavy chain associated with axonemal dynein (Milisav and Affara, 1998 [PubMed 9545504]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110059E24Rik	T	C	19: 21,598,245		probably benign	Het
1700014D04Rik	T	C	13: 59,742,785	D407G	probably damaging	Het
9930021J03Rik	C	T	19: 29,716,675	S1873N	possibly damaging	Het
Apoh	G	A	11: 108,407,462	R196Q	probably benign	Het
Arnt	C	T	3: 95,448,393	S16L	possibly damaging	Het
B4galnt4	T	C	7: 141,064,848	F194L	probably benign	Het
BC034090	A	T	1: 155,225,226	L431M	possibly damaging	Het
Bdh2	G	T	3: 135,288,279	A31S	probably damaging	Het
Cacna1s	T	C	1: 136,119,095	S1821P	probably benign	Het
Caskin1	A	T	17: 24,506,850	Q1370L	possibly damaging	Het
Ccdc83	T	A	7: 90,244,154	S132C	probably damaging	Het
Cdk15	A	T	1: 59,330,951	H384L	probably damaging	Het
Col24a1	T	C	3: 145,314,930	I354T	probably benign	Het
Coro7	T	C	16: 4,633,756	I451V	probably benign	Het
Ctnna2	T	C	6: 77,758,500	E65G	probably damaging	Het
Ctsll3	A	T	13: 60,800,348	W172R	probably benign	Het
D230025D16Rik	T	A	8: 105,246,500	D247E	possibly damaging	Het
D630045J12Rik	T	C	6: 38,168,143	D1316G	probably damaging	Het
Ddx19b	C	T	8: 111,008,258	A493T	probably benign	Het
Ddx4	C	T	13: 112,600,013	V608I	probably damaging	Het
Ddx4	T	A	13: 112,620,742	H348L	probably damaging	Het
Dnah9	G	C	11: 65,848,371	N4180K	probably damaging	Het
Dok7	A	G	5: 35,077,266		probably null	Het
Dpf3	T	A	12: 83,325,035		probably null	Het
Elfn1	G	C	5: 139,972,849	R536P	probably damaging	Het
Eml6	A	G	11: 29,833,075	V602A	probably benign	Het
Enpp2	T	C	15: 54,882,982	D296G	probably damaging	Het
Evi5	A	T	5: 107,748,364	F738I	probably benign	Het
Eya2	T	C	2: 165,716,119	S212P	probably benign	Het
Fam83a	T	C	15: 57,986,102	L14P	probably damaging	Het
Fanca	A	T	8: 123,288,064	M735K	probably benign	Het
Fancm	T	A	12: 65,101,692	S694T	probably benign	Het
Fibcd1	G	A	2: 31,816,661	T386I	probably damaging	Het
Foxd4	A	G	19: 24,899,814	S341P	probably benign	Het
Foxp4	C	T	17: 47,875,871	R378Q	unknown	Het
Fryl	A	T	5: 73,098,266	S807R	probably benign	Het
Fscb	T	C	12: 64,473,234	E486G	unknown	Het
Galnt17	A	G	5: 131,150,944	S122P	probably benign	Het
Ghitm	A	G	14: 37,131,629	F85L	probably benign	Het
Ghrh	C	A	2: 157,333,466	V32L	probably benign	Het
Gli2	C	T	1: 118,837,700	R907H	probably benign	Het
Gm11639	A	G	11: 104,746,264	I988M	probably damaging	Het
Gm28042	A	G	2: 120,041,615	*1015W	probably null	Het
Gpr179	T	C	11: 97,337,958	T1124A	probably benign	Het
Grid2	C	A	6: 63,908,918	C99*	probably null	Het
Grin1	A	T	2: 25,297,915	M523K	probably benign	Het
Gucy2g	T	G	19: 55,233,053	T339P	probably benign	Het
Gucy2g	T	C	19: 55,222,896	Y634C	possibly damaging	Het
Haus6	A	T	4: 86,604,246	L116H	probably damaging	Het
Hey1	T	C	3: 8,666,819	T18A	probably benign	Het
Hipk3	T	C	2: 104,433,841	N792D	probably damaging	Het
Il19	A	T	1: 130,939,156	L29Q	probably damaging	Het
Il21r	A	G	7: 125,628,972	Q205R	probably damaging	Het
Kcnip2	T	C	19: 45,793,683	D169G	probably null	Het
Kctd18	T	C	1: 57,967,620	I24V	probably benign	Het
Lcp1	T	C	14: 75,200,506	S119P	probably damaging	Het
Lig3	G	C	11: 82,795,718	D642H	probably benign	Het
Lrba	A	G	3: 86,608,389	K2166E	probably damaging	Het
Lrrn2	T	C	1: 132,939,234	V679A	probably benign	Het
Lyst	G	A	13: 13,730,344	R3202H	probably damaging	Het
Micall2	A	G	5: 139,736,130	C11R	probably damaging	Het
Morc2b	T	G	17: 33,137,091	Q569P	probably benign	Het
Mtrf1	A	G	14: 79,401,671	E81G	probably damaging	Het
Myh2	G	T	11: 67,189,178	S1099I	possibly damaging	Het
Nap1l1	T	A	10: 111,491,053	D158E	probably benign	Het
Nckap5l	T	A	15: 99,422,818	T1285S	probably damaging	Het
Nsrp1	A	T	11: 77,045,786	M528K	probably damaging	Het
Numa1	C	T	7: 102,009,322	A1605V	probably damaging	Het
Nutm2	T	C	13: 50,473,842	L453P	probably damaging	Het
Ofd1	T	C	X: 166,427,214	Y205C	probably benign	Het
Olfr1233	T	A	2: 89,340,296	N2I	probably damaging	Het
Olfr135	A	G	17: 38,208,464	Y73C	probably damaging	Het
Olfr19	T	A	16: 16,673,583	M133L	probably benign	Het
Olfr552	A	T	7: 102,604,570	D72V	probably damaging	Het
Olfr693	T	A	7: 106,677,670	N272I	probably damaging	Het
Patl1	T	C	19: 11,921,418	L159P	probably benign	Het
Paxip1	G	A	5: 27,744,136	T1045I	probably damaging	Het
Pik3ca	A	G	3: 32,451,754		probably null	Het
Pkhd1	T	A	1: 20,381,523	I2183F	probably damaging	Het
Plec	C	T	15: 76,189,172	R319H	probably damaging	Het
Pnkd	G	A	1: 74,351,849	G334D	probably damaging	Het
Prss50	A	G	9: 110,862,381	Y251C	probably damaging	Het
Rab11b	A	T	17: 33,760,235	Y10N	probably damaging	Het
Rfc1	G	A	5: 65,319,524	R4W	probably damaging	Het
Rgs19	A	T	2: 181,689,483	F119Y	probably damaging	Het
Safb	A	G	17: 56,605,821	H883R	probably benign	Het
Serpine1	G	A	5: 137,067,747	Q227*	probably null	Het
Slc25a13	A	G	6: 6,096,668		probably null	Het
Slc6a18	T	A	13: 73,664,189	T502S	possibly damaging	Het
Sox4	T	C	13: 28,952,648	D125G	probably damaging	Het
Stag3	C	T	5: 138,300,138	T731I	probably damaging	Het
Thada	G	T	17: 84,310,042	P1349T	probably damaging	Het
Tmem245	C	A	4: 56,937,964	V195F	probably benign	Het
Tnxb	A	G	17: 34,679,081	H901R	probably benign	Het
Trim39	A	T	17: 36,268,753	D103E	probably benign	Het
Ttn	A	T	2: 76,731,960	V28847E	probably damaging	Het
Tubb1	A	T	2: 174,455,691	D31V	possibly damaging	Het
Ush1g	A	G	11: 115,318,454	S305P	probably damaging	Het
Vmn1r191	A	T	13: 22,178,782	N267K	possibly damaging	Het
Vmn1r59	A	T	7: 5,454,039	Y241N	probably damaging	Het
Vmn2r49	T	C	7: 9,986,308	N419D	probably damaging	Het
Vps35	T	C	8: 85,278,994	D326G	possibly damaging	Het
Xdh	A	G	17: 73,892,751	S1187P	possibly damaging	Het
Xpc	A	C	6: 91,501,025		probably null	Het
Zfp273	T	C	13: 67,825,163	Y104H	probably damaging	Het

Other mutations in Dnah17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00231:Dnah17	APN	11	118088214	missense	possibly damaging	0.81
IGL00531:Dnah17	APN	11	118043173	missense	probably damaging	0.97
IGL00764:Dnah17	APN	11	118096485	missense	probably damaging	0.99
IGL00795:Dnah17	APN	11	118093634	missense	probably benign	0.35
IGL00823:Dnah17	APN	11	118047161	missense	probably benign	0.22
IGL01145:Dnah17	APN	11	118047173	missense	possibly damaging	0.63
IGL01433:Dnah17	APN	11	118049934	missense	probably damaging	1.00
IGL01454:Dnah17	APN	11	118058397	missense	probably damaging	1.00
IGL01545:Dnah17	APN	11	118119568	missense	probably damaging	1.00
IGL01548:Dnah17	APN	11	118098612	missense	probably benign	0.21
IGL01557:Dnah17	APN	11	118073686	missense	probably damaging	0.98
IGL01632:Dnah17	APN	11	118033881	missense	probably damaging	1.00
IGL01636:Dnah17	APN	11	118041056	missense	probably benign	0.03
IGL01672:Dnah17	APN	11	118042160	missense	probably damaging	0.97
IGL01822:Dnah17	APN	11	118081993	missense	probably damaging	1.00
IGL01869:Dnah17	APN	11	118052676	missense	probably benign	0.09
IGL01916:Dnah17	APN	11	118125288	missense	probably benign	0.00
IGL02131:Dnah17	APN	11	118072908	missense	probably damaging	1.00
IGL02154:Dnah17	APN	11	118124261	missense	probably benign	0.01
IGL02220:Dnah17	APN	11	118072967	nonsense	probably null
IGL02454:Dnah17	APN	11	118080767	missense	probably damaging	0.98
IGL02458:Dnah17	APN	11	118036350	missense	probably damaging	1.00
IGL02588:Dnah17	APN	11	118025653	missense	possibly damaging	0.95
IGL02865:Dnah17	APN	11	118073548	missense	probably damaging	1.00
IGL02881:Dnah17	APN	11	118042118	missense	probably damaging	1.00
IGL02952:Dnah17	APN	11	118088268	missense	probably benign	0.03
IGL03382:Dnah17	APN	11	118081943	missense	probably damaging	1.00
IGL03389:Dnah17	APN	11	118094979	missense	probably damaging	1.00
ergos	UTSW	11	118041158	splice site	probably benign
watt	UTSW	11	118080766	missense	probably damaging	0.96
PIT4280001:Dnah17	UTSW	11	118098582	missense	possibly damaging	0.85
R0004:Dnah17	UTSW	11	118060092	missense	possibly damaging	0.90
R0112:Dnah17	UTSW	11	118074434	missense	possibly damaging	0.82
R0116:Dnah17	UTSW	11	118058306	missense	probably benign	0.01
R0157:Dnah17	UTSW	11	118127171	missense	probably benign
R0320:Dnah17	UTSW	11	118052674	missense	possibly damaging	0.56
R0362:Dnah17	UTSW	11	118098539	missense	probably benign	0.10
R0382:Dnah17	UTSW	11	118128996	missense	probably damaging	1.00
R0383:Dnah17	UTSW	11	118067547	missense	probably benign
R0400:Dnah17	UTSW	11	118082078	missense	probably damaging	1.00
R0420:Dnah17	UTSW	11	118039939	missense	probably damaging	1.00
R0483:Dnah17	UTSW	11	118047124	missense	probably benign
R0533:Dnah17	UTSW	11	118110537	missense	possibly damaging	0.50
R0562:Dnah17	UTSW	11	118072900	missense	probably damaging	1.00
R0564:Dnah17	UTSW	11	118082981	missense	probably damaging	1.00
R0604:Dnah17	UTSW	11	118121471	missense	probably benign	0.00
R0608:Dnah17	UTSW	11	118090749	nonsense	probably null
R0614:Dnah17	UTSW	11	118070568	splice site	probably benign
R0632:Dnah17	UTSW	11	118067682	splice site	probably benign
R0831:Dnah17	UTSW	11	118060271	missense	probably damaging	0.99
R0838:Dnah17	UTSW	11	118060104	missense	probably damaging	1.00
R0879:Dnah17	UTSW	11	118056835	splice site	probably benign
R1061:Dnah17	UTSW	11	118052688	missense	possibly damaging	0.51
R1190:Dnah17	UTSW	11	118042175	missense	probably damaging	1.00
R1293:Dnah17	UTSW	11	118127137	critical splice donor site	probably null
R1297:Dnah17	UTSW	11	118121366	splice site	probably benign
R1332:Dnah17	UTSW	11	118043215	missense	possibly damaging	0.70
R1336:Dnah17	UTSW	11	118043215	missense	possibly damaging	0.70
R1364:Dnah17	UTSW	11	118125606	splice site	probably benign
R1418:Dnah17	UTSW	11	118074023	missense	probably damaging	0.98
R1432:Dnah17	UTSW	11	118023327	missense	probably damaging	1.00
R1497:Dnah17	UTSW	11	118114233	missense	probably damaging	1.00
R1500:Dnah17	UTSW	11	118101053	missense	probably benign
R1506:Dnah17	UTSW	11	118125387	missense	possibly damaging	0.53
R1512:Dnah17	UTSW	11	118095015	missense	probably benign
R1567:Dnah17	UTSW	11	118125985	missense	probably damaging	1.00
R1597:Dnah17	UTSW	11	118103498	splice site	probably benign
R1665:Dnah17	UTSW	11	118121495	splice site	probably benign
R1703:Dnah17	UTSW	11	118026749	missense	probably damaging	1.00
R1716:Dnah17	UTSW	11	118032598	missense	probably benign	0.00
R1727:Dnah17	UTSW	11	118070489	missense	probably damaging	0.98
R1727:Dnah17	UTSW	11	118096536	nonsense	probably null
R1728:Dnah17	UTSW	11	118069519	missense	possibly damaging	0.76
R1784:Dnah17	UTSW	11	118069519	missense	possibly damaging	0.76
R1852:Dnah17	UTSW	11	118121916	missense	probably damaging	0.97
R1869:Dnah17	UTSW	11	118047189	nonsense	probably null
R1886:Dnah17	UTSW	11	118108161	missense	possibly damaging	0.62
R1893:Dnah17	UTSW	11	118066968	missense	probably benign	0.00
R1954:Dnah17	UTSW	11	118024731	missense	probably damaging	1.00
R1971:Dnah17	UTSW	11	118104535	missense	probably benign	0.00
R1975:Dnah17	UTSW	11	118096536	nonsense	probably null
R1977:Dnah17	UTSW	11	118112591	missense	possibly damaging	0.52
R2055:Dnah17	UTSW	11	118067531	missense	probably benign	0.00
R2115:Dnah17	UTSW	11	118119802	missense	probably benign	0.00
R2132:Dnah17	UTSW	11	118033747	missense	probably damaging	0.98
R2200:Dnah17	UTSW	11	118102409	splice site	probably benign
R2277:Dnah17	UTSW	11	118096561	missense	possibly damaging	0.81
R2279:Dnah17	UTSW	11	118096561	missense	possibly damaging	0.81
R2400:Dnah17	UTSW	11	118126384	critical splice acceptor site	probably null
R2402:Dnah17	UTSW	11	118125974	missense	probably benign	0.10
R2497:Dnah17	UTSW	11	118087024	splice site	probably null
R2923:Dnah17	UTSW	11	118093547	missense	probably damaging	1.00
R3121:Dnah17	UTSW	11	118041086	missense	probably damaging	1.00
R3236:Dnah17	UTSW	11	118094854	missense	probably benign	0.08
R3237:Dnah17	UTSW	11	118094854	missense	probably benign	0.08
R3498:Dnah17	UTSW	11	118080849	splice site	probably benign
R3499:Dnah17	UTSW	11	118080849	splice site	probably benign
R3746:Dnah17	UTSW	11	118082916	missense	probably benign	0.00
R3749:Dnah17	UTSW	11	118082916	missense	probably benign	0.00
R3762:Dnah17	UTSW	11	118104526	missense	probably benign	0.00
R3826:Dnah17	UTSW	11	118041158	splice site	probably benign
R3828:Dnah17	UTSW	11	118041158	splice site	probably benign
R3829:Dnah17	UTSW	11	118041158	splice site	probably benign
R3877:Dnah17	UTSW	11	118024707	missense	probably damaging	1.00
R3899:Dnah17	UTSW	11	118094808	missense	possibly damaging	0.78
R3900:Dnah17	UTSW	11	118094808	missense	possibly damaging	0.78
R3911:Dnah17	UTSW	11	118080849	splice site	probably benign
R3913:Dnah17	UTSW	11	118080849	splice site	probably benign
R3930:Dnah17	UTSW	11	118080849	splice site	probably benign
R3931:Dnah17	UTSW	11	118080849	splice site	probably benign
R3969:Dnah17	UTSW	11	118041158	splice site	probably benign
R3970:Dnah17	UTSW	11	118041158	splice site	probably benign
R4056:Dnah17	UTSW	11	118070538	missense	probably benign	0.05
R4113:Dnah17	UTSW	11	118112594	missense	possibly damaging	0.50
R4295:Dnah17	UTSW	11	118118772	missense	probably damaging	1.00
R4324:Dnah17	UTSW	11	118094213	missense	probably benign	0.01
R4412:Dnah17	UTSW	11	118073683	missense	probably damaging	1.00
R4413:Dnah17	UTSW	11	118025168	missense	probably benign	0.00
R4422:Dnah17	UTSW	11	118081973	missense	possibly damaging	0.91
R4552:Dnah17	UTSW	11	118052943	missense	possibly damaging	0.79
R4669:Dnah17	UTSW	11	118074293	missense	probably benign	0.02
R4677:Dnah17	UTSW	11	118119814	missense	probably damaging	1.00
R4716:Dnah17	UTSW	11	118073648	missense	probably benign	0.02
R4832:Dnah17	UTSW	11	118026780	missense	probably damaging	1.00
R4868:Dnah17	UTSW	11	118108212	missense	probably benign	0.03
R4897:Dnah17	UTSW	11	118078593	missense	probably damaging	1.00
R4928:Dnah17	UTSW	11	118027433	missense	probably damaging	1.00
R4937:Dnah17	UTSW	11	118042154	missense	probably damaging	1.00
R4957:Dnah17	UTSW	11	118074298	missense	probably benign	0.44
R5008:Dnah17	UTSW	11	118110577	missense	probably benign	0.01
R5016:Dnah17	UTSW	11	118080766	missense	probably damaging	0.96
R5027:Dnah17	UTSW	11	118102539	missense	probably benign	0.01
R5133:Dnah17	UTSW	11	118117113	missense	probably benign	0.00
R5140:Dnah17	UTSW	11	118086945	missense	probably damaging	1.00
R5146:Dnah17	UTSW	11	118114179	missense	probably damaging	0.99
R5151:Dnah17	UTSW	11	118027467	missense	probably damaging	1.00
R5153:Dnah17	UTSW	11	118082974	nonsense	probably null
R5192:Dnah17	UTSW	11	118034359	missense	possibly damaging	0.96
R5315:Dnah17	UTSW	11	118127283	missense	possibly damaging	0.79
R5317:Dnah17	UTSW	11	118127283	missense	possibly damaging	0.79
R5335:Dnah17	UTSW	11	118112514	missense	probably damaging	1.00
R5379:Dnah17	UTSW	11	118117203	intron	probably benign
R5396:Dnah17	UTSW	11	118127282	missense	probably benign
R5418:Dnah17	UTSW	11	118094984	missense	probably benign	0.04
R5534:Dnah17	UTSW	11	118052770	missense	possibly damaging	0.83
R5539:Dnah17	UTSW	11	118073660	missense	probably benign	0.03
R5594:Dnah17	UTSW	11	118043229	splice site	probably null
R5634:Dnah17	UTSW	11	118052926	splice site	probably null
R5696:Dnah17	UTSW	11	118101056	missense	probably benign	0.44
R5802:Dnah17	UTSW	11	118036446	missense	possibly damaging	0.79
R5826:Dnah17	UTSW	11	118034367	missense	probably damaging	1.00
R5873:Dnah17	UTSW	11	118056897	missense	probably benign	0.01
R5898:Dnah17	UTSW	11	118114213	missense	probably benign	0.00
R5934:Dnah17	UTSW	11	118041102	missense	probably benign
R6030:Dnah17	UTSW	11	118025549	missense	probably benign	0.32
R6030:Dnah17	UTSW	11	118025549	missense	probably benign	0.32
R6038:Dnah17	UTSW	11	118055889	missense	probably benign	0.00
R6038:Dnah17	UTSW	11	118055889	missense	probably benign	0.00
R6113:Dnah17	UTSW	11	118126275	missense	probably damaging	1.00
R6117:Dnah17	UTSW	11	118119571	missense	probably benign	0.00
R6137:Dnah17	UTSW	11	118025654	missense	probably damaging	1.00
R6173:Dnah17	UTSW	11	118039946	missense	probably damaging	1.00
R6258:Dnah17	UTSW	11	118126322	missense	probably damaging	1.00
R6258:Dnah17	UTSW	11	118126323	nonsense	probably null
R6258:Dnah17	UTSW	11	118126324	missense	probably damaging	1.00
R6260:Dnah17	UTSW	11	118126322	missense	probably damaging	1.00
R6260:Dnah17	UTSW	11	118126323	nonsense	probably null
R6260:Dnah17	UTSW	11	118126324	missense	probably damaging	1.00
R6278:Dnah17	UTSW	11	118126290	missense	probably damaging	0.99
R6298:Dnah17	UTSW	11	118108161	missense	probably benign	0.00
R6300:Dnah17	UTSW	11	118034310	missense	probably damaging	1.00
R6302:Dnah17	UTSW	11	118129155	missense	probably benign	0.09
R6363:Dnah17	UTSW	11	118110505	missense	probably benign
R6381:Dnah17	UTSW	11	118129185	missense	probably benign	0.08
R6418:Dnah17	UTSW	11	118129197	missense	probably damaging	0.99
R6660:Dnah17	UTSW	11	118100188	missense	probably benign
R6803:Dnah17	UTSW	11	118125372	missense	probably benign	0.00
R6820:Dnah17	UTSW	11	118069000	missense	probably damaging	0.99
R6885:Dnah17	UTSW	11	118090772	missense	possibly damaging	0.47
R6921:Dnah17	UTSW	11	118041484	missense	probably damaging	0.98
R6932:Dnah17	UTSW	11	118060079	missense	possibly damaging	0.95
R6954:Dnah17	UTSW	11	118066432	missense	probably damaging	1.00
R7000:Dnah17	UTSW	11	118025702	critical splice acceptor site	probably null
R7007:Dnah17	UTSW	11	118118871	missense	possibly damaging	0.92
R7048:Dnah17	UTSW	11	118046118	missense	possibly damaging	0.80
R7056:Dnah17	UTSW	11	118125386	missense	probably benign
R7131:Dnah17	UTSW	11	118079658	missense	probably benign	0.14
R7143:Dnah17	UTSW	11	118086130	missense	probably damaging	1.00
R7146:Dnah17	UTSW	11	118082110	missense	probably damaging	0.98
R7147:Dnah17	UTSW	11	118094929	missense	probably benign	0.31
R7172:Dnah17	UTSW	11	118041131	nonsense	probably null
R7183:Dnah17	UTSW	11	118129188	missense	probably benign
R7297:Dnah17	UTSW	11	118055730	critical splice donor site	probably null
R7297:Dnah17	UTSW	11	118103356	missense	probably damaging	0.98
R7367:Dnah17	UTSW	11	118115196	missense	probably benign
R7398:Dnah17	UTSW	11	118080724	missense	probably damaging	0.96
R7426:Dnah17	UTSW	11	118090717	missense	probably null	0.79
R7524:Dnah17	UTSW	11	118121481	missense	probably benign	0.03
R7529:Dnah17	UTSW	11	118049866	critical splice donor site	probably null
R7615:Dnah17	UTSW	11	118110547	nonsense	probably null
R7681:Dnah17	UTSW	11	118025186	missense	probably damaging	1.00
R7702:Dnah17	UTSW	11	118025640	missense	probably benign	0.00
R7702:Dnah17	UTSW	11	118121478	missense	possibly damaging	0.64
R7713:Dnah17	UTSW	11	118025171	missense	probably benign	0.02
R7809:Dnah17	UTSW	11	118104636	missense	probably benign	0.09
R7842:Dnah17	UTSW	11	118079682	critical splice acceptor site	probably null
R7935:Dnah17	UTSW	11	118127222	missense	probably benign	0.20
R7951:Dnah17	UTSW	11	118118766	missense	possibly damaging	0.64
R8070:Dnah17	UTSW	11	118024671	missense	probably damaging	0.97
R8098:Dnah17	UTSW	11	118050367	missense	probably damaging	1.00
R8101:Dnah17	UTSW	11	118125918	missense	probably benign
R8177:Dnah17	UTSW	11	118128927	missense	possibly damaging	0.60
R8343:Dnah17	UTSW	11	118114195	missense	probably benign
R8350:Dnah17	UTSW	11	118087047	missense	probably damaging	0.98
R8393:Dnah17	UTSW	11	118057029	missense	probably damaging	1.00
R8401:Dnah17	UTSW	11	118024659	missense	probably damaging	0.96
R8418:Dnah17	UTSW	11	118103458	missense	probably benign	0.01
R8450:Dnah17	UTSW	11	118087047	missense	probably damaging	0.98
R8546:Dnah17	UTSW	11	118124275	missense	probably benign	0.00
R8697:Dnah17	UTSW	11	118086159	missense	possibly damaging	0.96
R8710:Dnah17	UTSW	11	118042147	missense	probably damaging	1.00
R8713:Dnah17	UTSW	11	118088202	missense	probably damaging	1.00
R8722:Dnah17	UTSW	11	118070457	nonsense	probably null
R8797:Dnah17	UTSW	11	118101375	missense	probably benign	0.00
R8953:Dnah17	UTSW	11	118125412	splice site	probably benign
R8965:Dnah17	UTSW	11	118024666	missense	probably damaging	1.00
R8976:Dnah17	UTSW	11	118026840	missense	probably damaging	1.00
R9090:Dnah17	UTSW	11	118041044	missense	probably damaging	1.00
R9128:Dnah17	UTSW	11	118046178	missense	possibly damaging	0.76
R9134:Dnah17	UTSW	11	118088146	missense	probably damaging	1.00
R9245:Dnah17	UTSW	11	118125677	missense	probably benign	0.02
R9251:Dnah17	UTSW	11	118121792	missense	probably benign	0.03
R9271:Dnah17	UTSW	11	118041044	missense	probably damaging	1.00
R9367:Dnah17	UTSW	11	118096638	missense	possibly damaging	0.95
R9367:Dnah17	UTSW	11	118121386	missense	possibly damaging	0.93
R9381:Dnah17	UTSW	11	118023393	missense	probably benign
R9405:Dnah17	UTSW	11	118118911	missense	probably benign
R9449:Dnah17	UTSW	11	118096626	missense	probably benign	0.07
R9517:Dnah17	UTSW	11	118024614	missense	possibly damaging	0.76
R9588:Dnah17	UTSW	11	118121957	missense	probably benign	0.00
R9629:Dnah17	UTSW	11	118088978	missense	probably damaging	1.00
R9654:Dnah17	UTSW	11	118036330	critical splice donor site	probably null
R9655:Dnah17	UTSW	11	118080823	missense	possibly damaging	0.94
R9662:Dnah17	UTSW	11	118034340	missense	probably damaging	0.97
R9686:Dnah17	UTSW	11	118088222	missense	possibly damaging	0.46
R9689:Dnah17	UTSW	11	118072905	missense	probably damaging	1.00
R9706:Dnah17	UTSW	11	118126200	missense	probably damaging	1.00
X0058:Dnah17	UTSW	11	118082925	missense	probably damaging	1.00
Z1176:Dnah17	UTSW	11	118127166	missense	probably benign	0.01
Z1177:Dnah17	UTSW	11	118078563	missense	possibly damaging	0.91
Z1177:Dnah17	UTSW	11	118086960	missense	probably damaging	1.00
Z1177:Dnah17	UTSW	11	118127142	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CTTTCAAATCAGGCCTGTGGG -3'
(R):5'- AGGATGCTCTTCCAGGTCTG -3'

Sequencing Primer
(F):5'- GGGAGGGGGTCGTCTAC -3'
(R):5'- CTGTCTCTCATGAAGGCAAATGAC -3'

Posted On

2014-08-25