Incidental Mutation 'R0136:Bcl3'
ID21951
Institutional Source Beutler Lab
Gene Symbol Bcl3
Ensembl Gene ENSMUSG00000053175
Gene NameB cell leukemia/lymphoma 3
SynonymsBcl-3
MMRRC Submission 038421-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0136 (G1)
Quality Score133
Status Validated (trace)
Chromosome7
Chromosomal Location19808462-19822770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19809569 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 324 (V324A)
Ref Sequence ENSEMBL: ENSMUSP00000113851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120537] [ENSMUST00000135609]
Predicted Effect probably damaging
Transcript: ENSMUST00000120537
AA Change: V324A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113851
Gene: ENSMUSG00000053175
AA Change: V324A

DomainStartEndE-ValueType
ANK 129 162 4.01e0 SMART
ANK 166 195 4.43e-2 SMART
ANK 199 230 8.99e-3 SMART
ANK 236 265 3.23e-4 SMART
ANK 270 299 5.79e-6 SMART
ANK 303 332 1.4e1 SMART
low complexity region 377 402 N/A INTRINSIC
low complexity region 425 447 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128181
Predicted Effect possibly damaging
Transcript: ENSMUST00000135609
AA Change: V32A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117754
Gene: ENSMUSG00000053175
AA Change: V32A

DomainStartEndE-ValueType
Pfam:Ank_5 1 52 7.2e-7 PFAM
low complexity region 85 94 N/A INTRINSIC
low complexity region 100 114 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139680
SMART Domains Protein: ENSMUSP00000116129
Gene: ENSMUSG00000053175

DomainStartEndE-ValueType
ANK 66 99 4.01e0 SMART
ANK 103 132 4.43e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152768
Meta Mutation Damage Score 0.3220 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 89% (56/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a proto-oncogene candidate. It is identified by its translocation into the immunoglobulin alpha-locus in some cases of B-cell leukemia. The protein encoded by this gene contains seven ankyrin repeats, which are most closely related to those found in I kappa B proteins. This protein functions as a transcriptional co-activator that activates through its association with NF-kappa B homodimers. The expression of this gene can be induced by NF-kappa B, which forms a part of the autoregulatory loop that controls the nuclear residence of p50 NF-kappa B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice lacking functional copies of this gene exhibit defects of the immune system including disruption of the humoral immune response and abnormal spleen and Peyer's patch organogenesis. Mutant mice show increased susceptibility to pathogens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap4b1 T C 3: 103,809,946 M1T probably null Het
Arg2 T C 12: 79,150,006 L167P probably damaging Het
Atxn1 A G 13: 45,567,169 S417P probably damaging Het
Baz2b A G 2: 59,901,954 V1949A probably benign Het
Btbd10 A T 7: 113,329,878 S230T possibly damaging Het
Camta1 A G 4: 151,078,969 S1479P probably damaging Het
Cd69 C T 6: 129,270,062 S64N probably benign Het
Col5a1 T C 2: 28,024,831 L153P probably damaging Het
Crat C A 2: 30,407,030 V304L probably benign Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Fau T C 19: 6,059,180 V86A possibly damaging Het
Garem1 T G 18: 21,129,991 S589R probably damaging Het
Gbp3 T G 3: 142,564,101 probably null Het
Gin1 T A 1: 97,783,016 S141R possibly damaging Het
Gtf2h1 A T 7: 46,815,416 Q419L possibly damaging Het
Hipk3 A G 2: 104,439,293 I517T probably benign Het
Hivep2 T C 10: 14,131,878 S1407P probably benign Het
Hnrnpk G T 13: 58,395,177 D211E probably benign Het
Hnrnpul2 T C 19: 8,826,801 L588P probably damaging Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Itgb1 T G 8: 128,722,854 Y585D possibly damaging Het
Kmt2d C T 15: 98,854,278 probably benign Het
Map7d1 A T 4: 126,236,631 probably null Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Med13l A G 5: 118,724,050 T353A probably benign Het
Mgat4b T C 11: 50,231,081 V143A possibly damaging Het
Mlxip T A 5: 123,442,306 W211R probably damaging Het
Morc2a T G 11: 3,685,907 probably null Het
Muc4 A T 16: 32,750,195 probably benign Het
Ndufa10 A T 1: 92,463,128 Y233* probably null Het
Nek8 C T 11: 78,171,207 S237N probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nfatc2ip A G 7: 126,391,335 S165P probably benign Het
Nsd2 A G 5: 33,855,536 K404E possibly damaging Het
Nsd3 G T 8: 25,659,854 E352* probably null Het
Nudt9 A G 5: 104,047,106 T23A probably benign Het
Olfr394 T C 11: 73,887,785 M196V probably benign Het
Olfr394 C T 11: 73,887,830 V181I probably benign Het
Olfr983 A G 9: 40,092,019 *312Q probably null Het
Patj C A 4: 98,667,648 Q297K probably damaging Het
Pelo A T 13: 115,088,903 C40* probably null Het
Pnpla3 G A 15: 84,174,478 probably null Het
Pramel1 C A 4: 143,397,446 N230K probably damaging Het
Psg20 A C 7: 18,682,507 L228R probably damaging Het
Rsph10b T C 5: 143,959,821 F44L probably benign Het
Sept2 G A 1: 93,507,050 G358R possibly damaging Het
Slamf7 G A 1: 171,648,931 probably benign Het
Slc12a8 A G 16: 33,608,213 D297G probably damaging Het
Slc17a5 G A 9: 78,578,674 A43V probably damaging Het
Slc22a1 A T 17: 12,662,596 F335L probably benign Het
Slc26a5 T C 5: 21,834,347 N216S probably damaging Het
Snrnp27 T C 6: 86,676,205 S144G probably benign Het
Spata20 T A 11: 94,480,609 D643V probably damaging Het
Spata24 T C 18: 35,660,462 K99R probably damaging Het
Taar5 A G 10: 23,971,709 Y335C probably damaging Het
Tpr A G 1: 150,430,595 H1540R probably benign Het
Vmn1r27 A G 6: 58,215,719 F100S possibly damaging Het
Vmn2r37 A T 7: 9,217,783 Y360* probably null Het
Ybx1 C A 4: 119,282,354 R36L possibly damaging Het
Zfp369 A G 13: 65,297,202 K720E probably benign Het
Zfp599 A G 9: 22,249,742 S376P probably benign Het
Zic2 A G 14: 122,476,541 E289G probably damaging Het
Zzef1 T C 11: 72,821,851 V199A probably benign Het
Other mutations in Bcl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01510:Bcl3 APN 7 19809614 missense probably damaging 1.00
IGL01669:Bcl3 APN 7 19812491 nonsense probably null
IGL03024:Bcl3 APN 7 19809134 splice site probably benign
memorial UTSW 7 19812484 missense probably damaging 1.00
sunrise UTSW 7 19811580 nonsense probably null
sunrise2 UTSW 7 19809634 nonsense probably null
R0124:Bcl3 UTSW 7 19809651 missense probably damaging 1.00
R0554:Bcl3 UTSW 7 19820066 missense probably benign 0.26
R1845:Bcl3 UTSW 7 19809627 missense probably damaging 0.98
R2571:Bcl3 UTSW 7 19809527 missense probably damaging 1.00
R4355:Bcl3 UTSW 7 19811580 nonsense probably null
R4597:Bcl3 UTSW 7 19812503 missense probably damaging 0.97
R4993:Bcl3 UTSW 7 19820177 missense probably benign 0.00
R5587:Bcl3 UTSW 7 19809634 nonsense probably null
R6232:Bcl3 UTSW 7 19812484 missense probably damaging 1.00
R7439:Bcl3 UTSW 7 19822611 missense probably benign
R7565:Bcl3 UTSW 7 19812494 missense probably damaging 1.00
RF022:Bcl3 UTSW 7 19809041 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCAAGGCCATTGCGACCTTTATTC -3'
(R):5'- TTTGACACAGCCCCATGTCCAG -3'

Sequencing Primer
(F):5'- ACCAAAGTGTCCCGGTGAG -3'
(R):5'- CCATGTCCAGAATCATTTCAGG -3'
Posted On2013-04-12