Incidental Mutation 'R2010:Tmem229b-ps'
ID 219513
Institutional Source Beutler Lab
Gene Symbol Tmem229b-ps
Ensembl Gene ENSMUSG00000056219
Gene Name transmembrane protein 229B, pseudogene
Synonyms Gm5423
MMRRC Submission 040019-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.175) question?
Stock # R2010 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 53351060-53351565 bp(+) (GRCm39)
Type of Mutation exon
DNA Base Change (assembly) T to A at 53351295 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168554
SMART Domains Protein: ENSMUSP00000132002
Gene: ENSMUSG00000056219

DomainStartEndE-ValueType
Pfam:ABC_trans_CmpB 12 148 8.5e-14 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik G A 3: 36,535,955 (GRCm39) G74S unknown Het
Aimp1 A T 3: 132,373,253 (GRCm39) L229Q probably benign Het
Arhgef6 T C X: 56,344,865 (GRCm39) T52A possibly damaging Het
Aste1 C A 9: 105,280,701 (GRCm39) H25Q probably damaging Het
Atp13a1 G A 8: 70,244,010 (GRCm39) G36R possibly damaging Het
Bahcc1 T C 11: 120,163,604 (GRCm39) V634A probably damaging Het
Bltp1 T G 3: 36,982,700 (GRCm39) N788K probably benign Het
C1s1 A T 6: 124,514,353 (GRCm39) Y168N probably damaging Het
Camsap2 T C 1: 136,202,606 (GRCm39) S612G probably damaging Het
Cdh23 C A 10: 60,150,006 (GRCm39) R2611L probably damaging Het
Cfap20dc A T 14: 8,511,021 (GRCm38) F464L probably damaging Het
Cilp2 A G 8: 70,334,344 (GRCm39) Y885H probably damaging Het
Dhrs3 C T 4: 144,653,758 (GRCm39) T227I possibly damaging Het
Dnah2 A T 11: 69,349,184 (GRCm39) probably null Het
Dnah3 T G 7: 119,694,400 (GRCm39) M1L probably benign Het
Ehbp1l1 A G 19: 5,769,311 (GRCm39) I664T probably benign Het
Eif4e C T 3: 138,261,219 (GRCm39) T171I probably benign Het
Elfn1 C T 5: 139,959,071 (GRCm39) R692W probably damaging Het
Eps8l3 T A 3: 107,786,688 (GRCm39) M1K probably null Het
Evi5 C A 5: 107,961,411 (GRCm39) probably null Het
Fancd2 A T 6: 113,570,252 (GRCm39) D1401V probably damaging Het
Fat2 G A 11: 55,144,653 (GRCm39) R4074C probably damaging Het
Fkbp4 A T 6: 128,412,765 (GRCm39) V55E probably benign Het
Fnip1 A G 11: 54,373,329 (GRCm39) D180G probably damaging Het
Galc A G 12: 98,220,489 (GRCm39) F126S possibly damaging Het
Gdf7 C T 12: 8,351,729 (GRCm39) V69M unknown Het
Glis2 A G 16: 4,426,575 (GRCm39) E22G probably damaging Het
H2bc3 G A 13: 23,931,111 (GRCm39) V112M possibly damaging Het
Hps4 T A 5: 112,517,342 (GRCm39) V243E probably damaging Het
Ighe T A 12: 113,235,108 (GRCm39) I351F unknown Het
Irak4 A T 15: 94,449,687 (GRCm39) R55S probably damaging Het
Itpr2 G A 6: 146,129,022 (GRCm39) probably null Het
Katnip A G 7: 125,472,128 (GRCm39) I1544M possibly damaging Het
Kirrel3 T C 9: 34,850,494 (GRCm39) Y41H probably damaging Het
Krr1 A G 10: 111,811,474 (GRCm39) E56G possibly damaging Het
Lgi1 G A 19: 38,289,683 (GRCm39) V250I probably damaging Het
Lipf A G 19: 33,950,946 (GRCm39) N306D probably benign Het
Lman2l C T 1: 36,484,262 (GRCm39) W18* probably null Het
Lztfl1 T A 9: 123,531,251 (GRCm39) N239I possibly damaging Het
Mief1 T C 15: 80,132,126 (GRCm39) S66P possibly damaging Het
Mmp8 C A 9: 7,567,535 (GRCm39) S465* probably null Het
Muc2 A T 7: 141,287,444 (GRCm39) T208S probably damaging Het
Myh8 A T 11: 67,187,990 (GRCm39) K921* probably null Het
Myh9 T C 15: 77,656,147 (GRCm39) E1121G probably benign Het
Nbn T C 4: 15,969,393 (GRCm39) S213P probably damaging Het
Nol10 A G 12: 17,466,102 (GRCm39) E499G probably benign Het
Nxn T C 11: 76,289,627 (GRCm39) E87G probably damaging Het
Or14c40 A G 7: 86,313,811 (GRCm39) T314A probably benign Het
Or51f2 T A 7: 102,526,892 (GRCm39) C188* probably null Het
Or8g23 T C 9: 38,971,395 (GRCm39) H189R probably benign Het
Pds5b CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 5: 150,698,819 (GRCm39) probably benign Het
Pigk A G 3: 152,472,151 (GRCm39) I354M probably damaging Het
Pigl T A 11: 62,349,508 (GRCm39) C75S probably damaging Het
Pm20d1 T A 1: 131,739,852 (GRCm39) I400N probably benign Het
Prkg2 T A 5: 99,172,664 (GRCm39) H17L probably benign Het
Psmd1 T A 1: 86,003,719 (GRCm39) L168Q probably damaging Het
Rab3gap2 A T 1: 185,010,478 (GRCm39) H1136L possibly damaging Het
Rb1 T C 14: 73,532,433 (GRCm39) T134A probably benign Het
Rims1 T C 1: 22,367,220 (GRCm39) E1024G probably damaging Het
Rrp12 A G 19: 41,861,376 (GRCm39) V977A probably benign Het
Rusc2 C T 4: 43,415,212 (GRCm39) P173S probably benign Het
Selenov A T 7: 27,987,447 (GRCm39) D310E probably damaging Het
Serpina3f T A 12: 104,183,582 (GRCm39) L148Q probably damaging Het
Slc10a1 C T 12: 81,007,221 (GRCm39) V187I probably benign Het
Spsb2 A G 6: 124,787,339 (GRCm39) K258E probably damaging Het
Tas2r105 A C 6: 131,664,365 (GRCm39) V21G probably benign Het
Tnrc6a C G 7: 122,770,269 (GRCm39) H686Q probably benign Het
Trpc2 T A 7: 101,743,780 (GRCm39) F715L probably benign Het
Ube2t T A 1: 134,897,036 (GRCm39) I56N probably benign Het
Ubr4 T C 4: 139,207,963 (GRCm39) Y4915H possibly damaging Het
Usp32 T A 11: 84,930,830 (GRCm39) E533D probably damaging Het
Vipr2 T G 12: 116,086,430 (GRCm39) probably null Het
Vmn1r15 A G 6: 57,235,269 (GRCm39) T46A probably benign Het
Vmn1r203 T G 13: 22,708,617 (GRCm39) S133A possibly damaging Het
Vmn1r215 T G 13: 23,260,378 (GRCm39) N139K probably damaging Het
Vmn1r232 C T 17: 21,133,601 (GRCm39) R333H probably benign Het
Wdr20rt C A 12: 65,273,988 (GRCm39) H311N possibly damaging Het
Zranb1 T C 7: 132,568,425 (GRCm39) probably null Het
Other mutations in Tmem229b-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02309:Tmem229b-ps APN 10 53,351,466 (GRCm39) exon noncoding transcript
IGL02503:Tmem229b-ps APN 10 53,351,250 (GRCm39) exon noncoding transcript
IGL02600:Tmem229b-ps APN 10 53,351,052 (GRCm39) unclassified noncoding transcript
R1515:Tmem229b-ps UTSW 10 53,351,542 (GRCm39) exon noncoding transcript
R1595:Tmem229b-ps UTSW 10 53,351,385 (GRCm39) exon noncoding transcript
R2116:Tmem229b-ps UTSW 10 53,351,552 (GRCm39) exon noncoding transcript
R3498:Tmem229b-ps UTSW 10 53,351,223 (GRCm39) exon noncoding transcript
R3499:Tmem229b-ps UTSW 10 53,351,223 (GRCm39) exon noncoding transcript
R4281:Tmem229b-ps UTSW 10 53,351,474 (GRCm39) exon noncoding transcript
R5405:Tmem229b-ps UTSW 10 53,351,325 (GRCm39) exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- ATGCTATCCACGGCTACTTCTG -3'
(R):5'- CTCTGCGTCCTTGTCAAAGC -3'

Sequencing Primer
(F):5'- ACGGCTACTTCTGCGAGGTG -3'
(R):5'- TCCTTGTCAAAGCGCAGG -3'
Posted On 2014-08-25