Mutagenetix > Incidental Mutation

Incidental Mutation 'R1969:Lyst'

219517

Institutional Source

Beutler Lab

Gene Symbol

Lyst

Ensembl Gene

ENSMUSG00000019726

Gene Name

lysosomal trafficking regulator

Synonyms

D13Sfk13

MMRRC Submission

039982-MU

Accession Numbers

Ncbi RefSeq: NM_010748.2; MGI:107448

Essential gene?

Possibly non essential (E-score: 0.347) question?

Stock #

R1969 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

13590397-13778803 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 13730344 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 3202 (R3202H)

Ref Sequence

ENSEMBL: ENSMUSP00000106188 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110559]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000110559
AA Change: R3202H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000106188
Gene: ENSMUSG00000019726
AA Change: R3202H

Domain	Start	End	E-Value	Type
low complexity region	26	36	N/A	INTRINSIC
low complexity region	72	82	N/A	INTRINSIC
low complexity region	399	412	N/A	INTRINSIC
low complexity region	1333	1344	N/A	INTRINSIC
low complexity region	2295	2307	N/A	INTRINSIC
low complexity region	2427	2445	N/A	INTRINSIC
low complexity region	2534	2546	N/A	INTRINSIC
Pfam:PH_BEACH	3006	3101	5.8e-25	PFAM
Beach	3118	3408	1.25e-193	SMART
Blast:Beach	3441	3478	9e-13	BLAST
WD40	3539	3579	5.75e-1	SMART
WD40	3591	3630	2.89e-5	SMART
WD40	3633	3676	1.38e0	SMART
WD40	3724	3765	1.27e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221717

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.6%

Validation Efficiency

MGI Phenotype

Strain: 1855968
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that regulates intracellular protein trafficking in endosomes, and may be involved in pigmentation. Mutations in this gene are associated with Chediak-Higashi syndrome, a lysosomal storage disorder. Alternative splicing results in multiple transcript variants, though the full-length nature of some of these variants has not been determined. [provided by RefSeq, Apr 2013]
PHENOTYPE: Homozygous mice have a phenotype similar to human Chediak-Higashi syndrome patients, exhibiting lysosomal dysfunction with resultant protein storage; diluted coat color; abnormal melanogenesis; immune cell dysfunction resulting in increased susceptibility to bacterial, viral, and parasitic infections and decreased cytotoxic activity against tumor cells. [provided by MGI curators]

Allele List at MGI

All alleles(52) : Targeted(3) Gene trapped(34) Spontaneous(8) Chemically induced(6) Radiation induced(1)

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110059E24Rik	T	C	19: 21,598,245		probably benign	Het
1700014D04Rik	T	C	13: 59,742,785	D407G	probably damaging	Het
9930021J03Rik	C	T	19: 29,716,675	S1873N	possibly damaging	Het
Apoh	G	A	11: 108,407,462	R196Q	probably benign	Het
Arnt	C	T	3: 95,448,393	S16L	possibly damaging	Het
B4galnt4	T	C	7: 141,064,848	F194L	probably benign	Het
BC034090	A	T	1: 155,225,226	L431M	possibly damaging	Het
Bdh2	G	T	3: 135,288,279	A31S	probably damaging	Het
Cacna1s	T	C	1: 136,119,095	S1821P	probably benign	Het
Caskin1	A	T	17: 24,506,850	Q1370L	possibly damaging	Het
Ccdc83	T	A	7: 90,244,154	S132C	probably damaging	Het
Cdk15	A	T	1: 59,330,951	H384L	probably damaging	Het
Col24a1	T	C	3: 145,314,930	I354T	probably benign	Het
Coro7	T	C	16: 4,633,756	I451V	probably benign	Het
Ctnna2	T	C	6: 77,758,500	E65G	probably damaging	Het
Ctsll3	A	T	13: 60,800,348	W172R	probably benign	Het
D230025D16Rik	T	A	8: 105,246,500	D247E	possibly damaging	Het
D630045J12Rik	T	C	6: 38,168,143	D1316G	probably damaging	Het
Ddx19b	C	T	8: 111,008,258	A493T	probably benign	Het
Ddx4	C	T	13: 112,600,013	V608I	probably damaging	Het
Ddx4	T	A	13: 112,620,742	H348L	probably damaging	Het
Dnah17	G	C	11: 118,104,535	Q996E	probably benign	Het
Dnah9	G	C	11: 65,848,371	N4180K	probably damaging	Het
Dok7	A	G	5: 35,077,266		probably null	Het
Dpf3	T	A	12: 83,325,035		probably null	Het
Elfn1	G	C	5: 139,972,849	R536P	probably damaging	Het
Eml6	A	G	11: 29,833,075	V602A	probably benign	Het
Enpp2	T	C	15: 54,882,982	D296G	probably damaging	Het
Evi5	A	T	5: 107,748,364	F738I	probably benign	Het
Eya2	T	C	2: 165,716,119	S212P	probably benign	Het
Fam83a	T	C	15: 57,986,102	L14P	probably damaging	Het
Fanca	A	T	8: 123,288,064	M735K	probably benign	Het
Fancm	T	A	12: 65,101,692	S694T	probably benign	Het
Fibcd1	G	A	2: 31,816,661	T386I	probably damaging	Het
Foxd4	A	G	19: 24,899,814	S341P	probably benign	Het
Foxp4	C	T	17: 47,875,871	R378Q	unknown	Het
Fryl	A	T	5: 73,098,266	S807R	probably benign	Het
Fscb	T	C	12: 64,473,234	E486G	unknown	Het
Galnt17	A	G	5: 131,150,944	S122P	probably benign	Het
Ghitm	A	G	14: 37,131,629	F85L	probably benign	Het
Ghrh	C	A	2: 157,333,466	V32L	probably benign	Het
Gli2	C	T	1: 118,837,700	R907H	probably benign	Het
Gm11639	A	G	11: 104,746,264	I988M	probably damaging	Het
Gm28042	A	G	2: 120,041,615	*1015W	probably null	Het
Gpr179	T	C	11: 97,337,958	T1124A	probably benign	Het
Grid2	C	A	6: 63,908,918	C99*	probably null	Het
Grin1	A	T	2: 25,297,915	M523K	probably benign	Het
Gucy2g	T	C	19: 55,222,896	Y634C	possibly damaging	Het
Gucy2g	T	G	19: 55,233,053	T339P	probably benign	Het
Haus6	A	T	4: 86,604,246	L116H	probably damaging	Het
Hey1	T	C	3: 8,666,819	T18A	probably benign	Het
Hipk3	T	C	2: 104,433,841	N792D	probably damaging	Het
Il19	A	T	1: 130,939,156	L29Q	probably damaging	Het
Il21r	A	G	7: 125,628,972	Q205R	probably damaging	Het
Kcnip2	T	C	19: 45,793,683	D169G	probably null	Het
Kctd18	T	C	1: 57,967,620	I24V	probably benign	Het
Lcp1	T	C	14: 75,200,506	S119P	probably damaging	Het
Lig3	G	C	11: 82,795,718	D642H	probably benign	Het
Lrba	A	G	3: 86,608,389	K2166E	probably damaging	Het
Lrrn2	T	C	1: 132,939,234	V679A	probably benign	Het
Micall2	A	G	5: 139,736,130	C11R	probably damaging	Het
Morc2b	T	G	17: 33,137,091	Q569P	probably benign	Het
Mtrf1	A	G	14: 79,401,671	E81G	probably damaging	Het
Myh2	G	T	11: 67,189,178	S1099I	possibly damaging	Het
Nap1l1	T	A	10: 111,491,053	D158E	probably benign	Het
Nckap5l	T	A	15: 99,422,818	T1285S	probably damaging	Het
Nsrp1	A	T	11: 77,045,786	M528K	probably damaging	Het
Numa1	C	T	7: 102,009,322	A1605V	probably damaging	Het
Nutm2	T	C	13: 50,473,842	L453P	probably damaging	Het
Ofd1	T	C	X: 166,427,214	Y205C	probably benign	Het
Olfr1233	T	A	2: 89,340,296	N2I	probably damaging	Het
Olfr135	A	G	17: 38,208,464	Y73C	probably damaging	Het
Olfr19	T	A	16: 16,673,583	M133L	probably benign	Het
Olfr552	A	T	7: 102,604,570	D72V	probably damaging	Het
Olfr693	T	A	7: 106,677,670	N272I	probably damaging	Het
Patl1	T	C	19: 11,921,418	L159P	probably benign	Het
Paxip1	G	A	5: 27,744,136	T1045I	probably damaging	Het
Pik3ca	A	G	3: 32,451,754		probably null	Het
Pkhd1	T	A	1: 20,381,523	I2183F	probably damaging	Het
Plec	C	T	15: 76,189,172	R319H	probably damaging	Het
Pnkd	G	A	1: 74,351,849	G334D	probably damaging	Het
Prss50	A	G	9: 110,862,381	Y251C	probably damaging	Het
Rab11b	A	T	17: 33,760,235	Y10N	probably damaging	Het
Rfc1	G	A	5: 65,319,524	R4W	probably damaging	Het
Rgs19	A	T	2: 181,689,483	F119Y	probably damaging	Het
Safb	A	G	17: 56,605,821	H883R	probably benign	Het
Serpine1	G	A	5: 137,067,747	Q227*	probably null	Het
Slc25a13	A	G	6: 6,096,668		probably null	Het
Slc6a18	T	A	13: 73,664,189	T502S	possibly damaging	Het
Sox4	T	C	13: 28,952,648	D125G	probably damaging	Het
Stag3	C	T	5: 138,300,138	T731I	probably damaging	Het
Thada	G	T	17: 84,310,042	P1349T	probably damaging	Het
Tmem245	C	A	4: 56,937,964	V195F	probably benign	Het
Tnxb	A	G	17: 34,679,081	H901R	probably benign	Het
Trim39	A	T	17: 36,268,753	D103E	probably benign	Het
Ttn	A	T	2: 76,731,960	V28847E	probably damaging	Het
Tubb1	A	T	2: 174,455,691	D31V	possibly damaging	Het
Ush1g	A	G	11: 115,318,454	S305P	probably damaging	Het
Vmn1r191	A	T	13: 22,178,782	N267K	possibly damaging	Het
Vmn1r59	A	T	7: 5,454,039	Y241N	probably damaging	Het
Vmn2r49	T	C	7: 9,986,308	N419D	probably damaging	Het
Vps35	T	C	8: 85,278,994	D326G	possibly damaging	Het
Xdh	A	G	17: 73,892,751	S1187P	possibly damaging	Het
Xpc	A	C	6: 91,501,025		probably null	Het
Zfp273	T	C	13: 67,825,163	Y104H	probably damaging	Het

Other mutations in Lyst

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00156:Lyst	APN	13	13648878	missense	probably benign
IGL00474:Lyst	APN	13	13643536	missense	possibly damaging	0.48
IGL00484:Lyst	APN	13	13709603	missense	probably benign	0.02
IGL00492:Lyst	APN	13	13678175	missense	possibly damaging	0.54
IGL00807:Lyst	APN	13	13650423	missense	possibly damaging	0.91
IGL00949:Lyst	APN	13	13635485	missense	possibly damaging	0.87
IGL00952:Lyst	APN	13	13678107	missense	probably benign	0.05
IGL01305:Lyst	APN	13	13678056	missense	probably benign	0.01
IGL01317:Lyst	APN	13	13670870	missense	probably benign
IGL01419:Lyst	APN	13	13635838	missense	probably benign	0.00
IGL01445:Lyst	APN	13	13651714	missense	probably benign	0.00
IGL01690:Lyst	APN	13	13743246	missense	probably damaging	1.00
IGL01791:Lyst	APN	13	13635302	missense	probably damaging	1.00
IGL01809:Lyst	APN	13	13637803	missense	probably damaging	1.00
IGL01896:Lyst	APN	13	13635577	missense	probably benign	0.04
IGL01938:Lyst	APN	13	13637424	missense	possibly damaging	0.93
IGL01986:Lyst	APN	13	13775627	critical splice donor site	probably null
IGL02022:Lyst	APN	13	13664044	nonsense	probably null
IGL02044:Lyst	APN	13	13712846	missense	probably damaging	1.00
IGL02157:Lyst	APN	13	13660956	missense	probably benign
IGL02185:Lyst	APN	13	13661093	nonsense	probably null
IGL02215:Lyst	APN	13	13660956	missense	probably benign
IGL02245:Lyst	APN	13	13660956	missense	probably benign
IGL02246:Lyst	APN	13	13660956	missense	probably benign
IGL02247:Lyst	APN	13	13660956	missense	probably benign
IGL02297:Lyst	APN	13	13638092	nonsense	probably null
IGL02411:Lyst	APN	13	13660956	missense	probably benign
IGL02415:Lyst	APN	13	13660956	missense	probably benign
IGL02419:Lyst	APN	13	13660956	missense	probably benign
IGL02420:Lyst	APN	13	13660956	missense	probably benign
IGL02429:Lyst	APN	13	13660956	missense	probably benign
IGL02501:Lyst	APN	13	13711645	missense	probably benign	0.02
IGL02522:Lyst	APN	13	13634705	missense	possibly damaging	0.81
IGL02535:Lyst	APN	13	13650342	missense	probably benign	0.00
IGL02596:Lyst	APN	13	13660956	missense	probably benign
IGL02601:Lyst	APN	13	13660956	missense	probably benign
IGL02603:Lyst	APN	13	13660956	missense	probably benign
IGL02608:Lyst	APN	13	13712754	missense	probably damaging	0.98
IGL02622:Lyst	APN	13	13681390	missense	probably damaging	1.00
IGL02690:Lyst	APN	13	13641125	missense	possibly damaging	0.58
IGL02715:Lyst	APN	13	13674320	splice site	probably null
IGL02725:Lyst	APN	13	13760827	missense	probably damaging	1.00
IGL02729:Lyst	APN	13	13674339	missense	possibly damaging	0.81
IGL02729:Lyst	APN	13	13746609	missense	possibly damaging	0.95
IGL02820:Lyst	APN	13	13638058	missense	probably benign	0.03
IGL02945:Lyst	APN	13	13761198	missense	possibly damaging	0.48
IGL02981:Lyst	APN	13	13634911	missense	probably damaging	0.99
IGL03087:Lyst	APN	13	13635056	missense	probably damaging	1.00
IGL03149:Lyst	APN	13	13681444	missense	probably benign	0.14
IGL03158:Lyst	APN	13	13651752	critical splice donor site	probably null
IGL03226:Lyst	APN	13	13709559	missense	probably benign	0.01
IGL03242:Lyst	APN	13	13656881	nonsense	probably null
IGL03385:Lyst	APN	13	13656980	nonsense	probably null
50-cal	UTSW	13	13708212	critical splice donor site	probably null
charcoal	UTSW	13	13696761	nonsense	probably null
charlotte_gray	UTSW	13	13602026	intron	probably benign
charzard	UTSW	13	13647083	nonsense	probably null
grey_wolf	UTSW	13		unclassified
lightspeed	UTSW	13	13740536	missense	possibly damaging	0.91
pardon	UTSW	13	13677952	missense	probably benign	0.00
robin	UTSW	13	13648802	nonsense	probably null
sooty	UTSW	13		unclassified
souris	UTSW	13	13683223	unclassified	probably benign
Swallow	UTSW	13	13757422	missense	probably benign	0.00
vulpix	UTSW	13	13696794	splice site	probably null
ANU22:Lyst	UTSW	13	13678056	missense	probably benign	0.01
IGL02835:Lyst	UTSW	13	13661100	missense	possibly damaging	0.82
P0031:Lyst	UTSW	13	13664031	missense	probably damaging	1.00
R0012:Lyst	UTSW	13	13687694	missense	probably benign	0.10
R0012:Lyst	UTSW	13	13687694	missense	probably benign	0.10
R0031:Lyst	UTSW	13	13708156	missense	probably benign	0.14
R0115:Lyst	UTSW	13	13677952	missense	probably benign	0.00
R0212:Lyst	UTSW	13	13635985	missense	possibly damaging	0.93
R0386:Lyst	UTSW	13	13708214	splice site	probably benign
R0393:Lyst	UTSW	13	13647079	missense	probably benign	0.01
R0415:Lyst	UTSW	13	13711610	splice site	probably benign
R0446:Lyst	UTSW	13	13638048	missense	probably benign	0.00
R0481:Lyst	UTSW	13	13677952	missense	probably benign	0.00
R0499:Lyst	UTSW	13	13616713	missense	probably damaging	1.00
R0506:Lyst	UTSW	13	13638015	missense	probably benign
R0530:Lyst	UTSW	13	13757306	splice site	probably benign
R0541:Lyst	UTSW	13	13681293	missense	probably benign	0.00
R0570:Lyst	UTSW	13	13709386	missense	probably benign	0.26
R0680:Lyst	UTSW	13	13650341	missense	probably benign	0.01
R0842:Lyst	UTSW	13	13678241	nonsense	probably null
R0848:Lyst	UTSW	13	13634930	missense	probably benign	0.00
R1014:Lyst	UTSW	13	13634060	missense	possibly damaging	0.49
R1205:Lyst	UTSW	13	13680202	missense	probably benign
R1251:Lyst	UTSW	13	13634483	missense	probably benign	0.00
R1304:Lyst	UTSW	13	13751984	nonsense	probably null
R1398:Lyst	UTSW	13	13740536	missense	possibly damaging	0.91
R1445:Lyst	UTSW	13	13640054	missense	possibly damaging	0.94
R1475:Lyst	UTSW	13	13708212	critical splice donor site	probably null
R1479:Lyst	UTSW	13	13634482	missense	probably benign	0.00
R1484:Lyst	UTSW	13	13678190	missense	probably benign	0.01
R1498:Lyst	UTSW	13	13650375	missense	possibly damaging	0.49
R1540:Lyst	UTSW	13	13635101	missense	possibly damaging	0.81
R1611:Lyst	UTSW	13	13634897	missense	probably damaging	0.97
R1653:Lyst	UTSW	13	13635226	missense	probably damaging	1.00
R1669:Lyst	UTSW	13	13644087	missense	possibly damaging	0.90
R1686:Lyst	UTSW	13	13634705	missense	possibly damaging	0.81
R1694:Lyst	UTSW	13	13661161	missense	probably damaging	0.98
R1747:Lyst	UTSW	13	13757422	missense	probably benign	0.00
R1793:Lyst	UTSW	13	13647083	nonsense	probably null
R1871:Lyst	UTSW	13	13651712	missense	probably benign	0.00
R1905:Lyst	UTSW	13	13634134	missense	probably benign
R1958:Lyst	UTSW	13	13616618	missense	probably damaging	1.00
R2040:Lyst	UTSW	13	13641222	missense	probably benign	0.00
R2109:Lyst	UTSW	13	13712820	missense	possibly damaging	0.46
R2116:Lyst	UTSW	13	13635701	missense	probably damaging	0.99
R2121:Lyst	UTSW	13	13660971	missense	probably damaging	1.00
R2127:Lyst	UTSW	13	13635262	missense	probably damaging	1.00
R2187:Lyst	UTSW	13	13709341	missense	possibly damaging	0.61
R2238:Lyst	UTSW	13	13743263	missense	probably benign	0.41
R2258:Lyst	UTSW	13	13637658	missense	probably benign	0.00
R2292:Lyst	UTSW	13	13740495	missense	probably damaging	1.00
R2368:Lyst	UTSW	13	13696663	missense	probably damaging	0.96
R2908:Lyst	UTSW	13	13669873	missense	probably benign	0.03
R3001:Lyst	UTSW	13	13696705	missense	probably benign
R3002:Lyst	UTSW	13	13696705	missense	probably benign
R3024:Lyst	UTSW	13	13658687	missense	probably benign
R3113:Lyst	UTSW	13	13669927	missense	probably benign	0.12
R3406:Lyst	UTSW	13	13635230	missense	possibly damaging	0.56
R3972:Lyst	UTSW	13	13706625	missense	possibly damaging	0.67
R3978:Lyst	UTSW	13	13634168	missense	possibly damaging	0.82
R4032:Lyst	UTSW	13	13616665	missense	probably damaging	1.00
R4192:Lyst	UTSW	13	13740513	missense	probably damaging	1.00
R4206:Lyst	UTSW	13	13635989	missense	probably benign	0.03
R4298:Lyst	UTSW	13	13634887	missense	probably damaging	1.00
R4344:Lyst	UTSW	13	13698466	missense	probably benign	0.06
R4441:Lyst	UTSW	13	13635383	missense	probably damaging	1.00
R4445:Lyst	UTSW	13	13709564	missense	probably benign	0.42
R4477:Lyst	UTSW	13	13635383	missense	probably damaging	1.00
R4493:Lyst	UTSW	13	13635383	missense	probably damaging	1.00
R4494:Lyst	UTSW	13	13635383	missense	probably damaging	1.00
R4495:Lyst	UTSW	13	13635383	missense	probably damaging	1.00
R4622:Lyst	UTSW	13	13674398	missense	probably benign	0.01
R4638:Lyst	UTSW	13	13696794	splice site	probably null
R4658:Lyst	UTSW	13	13635383	missense	probably damaging	1.00
R4675:Lyst	UTSW	13	13635383	missense	probably damaging	1.00
R4719:Lyst	UTSW	13	13650350	missense	probably benign
R4729:Lyst	UTSW	13	13637901	missense	probably damaging	1.00
R4774:Lyst	UTSW	13	13740597	missense	probably damaging	1.00
R4811:Lyst	UTSW	13	13777100	missense	probably benign	0.33
R4877:Lyst	UTSW	13	13683149	missense	probably damaging	1.00
R4920:Lyst	UTSW	13	13647060	missense	possibly damaging	0.79
R4933:Lyst	UTSW	13	13637764	missense	probably damaging	0.98
R4933:Lyst	UTSW	13	13759378	missense	probably benign	0.12
R4958:Lyst	UTSW	13	13635463	missense	probably benign	0.00
R4982:Lyst	UTSW	13	13725954	missense	probably damaging	1.00
R4992:Lyst	UTSW	13	13661163	missense	probably damaging	1.00
R5024:Lyst	UTSW	13	13634404	missense	probably benign
R5049:Lyst	UTSW	13	13636064	missense	probably damaging	1.00
R5079:Lyst	UTSW	13	13757353	missense	probably benign	0.08
R5254:Lyst	UTSW	13	13683070	missense	probably benign	0.00
R5266:Lyst	UTSW	13	13660970	missense	probably damaging	1.00
R5279:Lyst	UTSW	13	13648802	nonsense	probably null
R5285:Lyst	UTSW	13	13634426	missense	probably benign	0.01
R5364:Lyst	UTSW	13	13656854	missense	probably benign	0.35
R5435:Lyst	UTSW	13	13777064	missense	possibly damaging	0.64
R5516:Lyst	UTSW	13	13644122	missense	probably benign	0.10
R5524:Lyst	UTSW	13	13746779	missense	probably benign	0.03
R5591:Lyst	UTSW	13	13743333	missense	probably damaging	0.99
R5592:Lyst	UTSW	13	13743333	missense	probably damaging	0.99
R5593:Lyst	UTSW	13	13743333	missense	probably damaging	0.99
R5594:Lyst	UTSW	13	13743333	missense	probably damaging	0.99
R5594:Lyst	UTSW	13	13759397	missense	probably benign	0.00
R5644:Lyst	UTSW	13	13637496	missense	possibly damaging	0.58
R5659:Lyst	UTSW	13	13634627	missense	possibly damaging	0.58
R5741:Lyst	UTSW	13	13634030	missense	probably benign	0.44
R5908:Lyst	UTSW	13	13696761	nonsense	probably null
R5969:Lyst	UTSW	13	13687813	splice site	probably null
R6128:Lyst	UTSW	13	13759379	missense	possibly damaging	0.67
R6271:Lyst	UTSW	13	13658754	missense	probably benign	0.30
R6315:Lyst	UTSW	13	13643504	missense	probably benign
R6318:Lyst	UTSW	13	13743311	missense	possibly damaging	0.88
R6555:Lyst	UTSW	13	13648925	missense	probably benign	0.01
R6663:Lyst	UTSW	13	13664116	splice site	probably null
R6701:Lyst	UTSW	13	13681485	missense	probably benign	0.06
R6711:Lyst	UTSW	13	13635235	missense	possibly damaging	0.80
R6909:Lyst	UTSW	13	13743375	missense	probably damaging	1.00
R6915:Lyst	UTSW	13	13726044	missense	probably benign	0.01
R6929:Lyst	UTSW	13	13743324	missense	probably damaging	1.00
R6960:Lyst	UTSW	13	13634078	missense	probably benign	0.12
R7018:Lyst	UTSW	13	13743459	critical splice donor site	probably null
R7037:Lyst	UTSW	13	13616666	missense	probably damaging	1.00
R7045:Lyst	UTSW	13	13634900	missense	probably benign	0.34
R7045:Lyst	UTSW	13	13637708	missense	probably damaging	1.00
R7070:Lyst	UTSW	13	13757444	missense	probably benign	0.23
R7188:Lyst	UTSW	13	13752090	missense	possibly damaging	0.66
R7201:Lyst	UTSW	13	13709300	nonsense	probably null
R7210:Lyst	UTSW	13	13656983	missense	probably damaging	1.00
R7229:Lyst	UTSW	13	13643509	missense	probably benign	0.00
R7293:Lyst	UTSW	13	13680237	missense	probably benign	0.01
R7318:Lyst	UTSW	13	13757443	missense	probably benign	0.13
R7344:Lyst	UTSW	13	13706555	missense	probably benign
R7426:Lyst	UTSW	13	13637524	missense	probably benign
R7522:Lyst	UTSW	13	13647083	nonsense	probably null
R7583:Lyst	UTSW	13	13635887	missense	probably damaging	1.00
R7606:Lyst	UTSW	13	13637475	missense	probably damaging	1.00
R7636:Lyst	UTSW	13	13616747	critical splice donor site	probably null
R7658:Lyst	UTSW	13	13730476	missense	possibly damaging	0.63
R7685:Lyst	UTSW	13	13669865	missense	probably benign	0.00
R7689:Lyst	UTSW	13	13683223	critical splice donor site	probably null
R7765:Lyst	UTSW	13	13709532	missense	possibly damaging	0.75
R7779:Lyst	UTSW	13	13634543	missense	probably damaging	1.00
R7871:Lyst	UTSW	13	13636052	nonsense	probably null
R7872:Lyst	UTSW	13	13635865	missense	probably benign	0.14
R7884:Lyst	UTSW	13	13707683	missense	probably benign	0.09
R7890:Lyst	UTSW	13	13740569	missense	probably damaging	0.99
R7916:Lyst	UTSW	13	13647072	missense	possibly damaging	0.64
R7948:Lyst	UTSW	13	13746589	missense	possibly damaging	0.59
R7956:Lyst	UTSW	13	13641203	missense	possibly damaging	0.80
R8048:Lyst	UTSW	13	13687645	missense	probably benign	0.12
R8085:Lyst	UTSW	13	13634309	missense	probably damaging	0.98
R8165:Lyst	UTSW	13	13698360	missense	probably damaging	0.99
R8235:Lyst	UTSW	13	13760738	missense	possibly damaging	0.69
R8237:Lyst	UTSW	13	13651732	missense	probably benign	0.00
R8275:Lyst	UTSW	13	13776082	missense	probably benign	0.02
R8300:Lyst	UTSW	13	13664058	missense	possibly damaging	0.79
R8350:Lyst	UTSW	13	13650388	nonsense	probably null
R8526:Lyst	UTSW	13	13760806	missense	probably damaging	0.99
R8551:Lyst	UTSW	13	13634060	missense	possibly damaging	0.77
R8723:Lyst	UTSW	13	13712757	missense	possibly damaging	0.89
R8772:Lyst	UTSW	13	13637492	nonsense	probably null
R8778:Lyst	UTSW	13	13635776	missense	possibly damaging	0.89
R8778:Lyst	UTSW	13	13728567	missense	possibly damaging	0.89
R8801:Lyst	UTSW	13	13661010	missense	probably benign	0.10
R8837:Lyst	UTSW	13	13677963	missense	probably benign
R8874:Lyst	UTSW	13	13637562	missense	probably benign
R8878:Lyst	UTSW	13	13641076	missense	probably benign	0.00
R8891:Lyst	UTSW	13	13712850	missense	possibly damaging	0.67
R9077:Lyst	UTSW	13	13683108	missense	probably benign	0.02
R9127:Lyst	UTSW	13	13634242	missense	probably damaging	1.00
R9143:Lyst	UTSW	13	13661165	missense	probably damaging	0.98
R9216:Lyst	UTSW	13	13648603	missense	probably benign
R9217:Lyst	UTSW	13	13696660	missense	probably benign	0.01
R9291:Lyst	UTSW	13	13709353	missense	probably benign	0.01
R9302:Lyst	UTSW	13	13730362	missense	possibly damaging	0.46
R9370:Lyst	UTSW	13	13760748	missense	probably damaging	1.00
R9402:Lyst	UTSW	13	13637878	missense	probably benign
R9457:Lyst	UTSW	13	13687745	missense	possibly damaging	0.83
R9481:Lyst	UTSW	13	13683068	missense	possibly damaging	0.68
R9563:Lyst	UTSW	13	13637823	missense	probably benign	0.36
R9623:Lyst	UTSW	13	13678002	missense	probably benign
R9661:Lyst	UTSW	13	13634194	missense	probably benign	0.01
R9682:Lyst	UTSW	13	13656941	missense	probably benign	0.21
R9743:Lyst	UTSW	13	13634738	missense	possibly damaging	0.67
R9801:Lyst	UTSW	13	13634705	missense	probably damaging	0.97
RF001:Lyst	UTSW	13	13635841	missense	probably benign
RF002:Lyst	UTSW	13	13634363	missense	probably benign	0.05
X0024:Lyst	UTSW	13	13634448	missense	probably benign	0.00
X0026:Lyst	UTSW	13	13751970	missense	probably damaging	0.99
Z1088:Lyst	UTSW	13	13743433	missense	probably benign	0.09
Z1176:Lyst	UTSW	13	13640107	missense	probably damaging	1.00
Z1176:Lyst	UTSW	13	13777079	missense	probably benign	0.27
Z1177:Lyst	UTSW	13	13680134	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- CTTATGACAGGGTAGCAGTGG -3'
(R):5'- TACAGCATGACTTTGGGGTAG -3'

Sequencing Primer
(F):5'- CTCATTTGGCCTAGGGTCAG -3'
(R):5'- CTTTGGGGTAGTTACAAAAGACATCC -3'

Posted On

2014-08-25