Incidental Mutation 'R1969:Lcp1'
ID 219541
Institutional Source Beutler Lab
Gene Symbol Lcp1
Ensembl Gene ENSMUSG00000021998
Gene Name lymphocyte cytosolic protein 1
Synonyms L-fimbrin, L-plastin, D14Ertd310e, Pls2
MMRRC Submission 039982-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1969 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 75368545-75468282 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 75437946 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 119 (S119P)
Ref Sequence ENSEMBL: ENSMUSP00000121376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122840] [ENSMUST00000124499] [ENSMUST00000125833] [ENSMUST00000131802] [ENSMUST00000134114] [ENSMUST00000145303] [ENSMUST00000143539]
AlphaFold Q61233
Predicted Effect probably benign
Transcript: ENSMUST00000122840
SMART Domains Protein: ENSMUSP00000117984
Gene: ENSMUSG00000021998

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124499
AA Change: S119P

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000121201
Gene: ENSMUSG00000021998
AA Change: S119P

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125833
SMART Domains Protein: ENSMUSP00000116033
Gene: ENSMUSG00000021998

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130510
Predicted Effect probably benign
Transcript: ENSMUST00000131802
AA Change: S119P

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000117137
Gene: ENSMUSG00000021998
AA Change: S119P

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000134114
AA Change: S119P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121376
Gene: ENSMUSG00000021998
AA Change: S119P

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145303
AA Change: S119P

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000116271
Gene: ENSMUSG00000021998
AA Change: S119P

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 81 7.7e-3 SMART
CH 122 234 1.15e-24 SMART
CH 266 373 1.51e-19 SMART
CH 396 501 1.87e-24 SMART
CH 517 622 8.55e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149883
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161819
Predicted Effect probably benign
Transcript: ENSMUST00000143539
SMART Domains Protein: ENSMUSP00000118721
Gene: ENSMUSG00000021998

DomainStartEndE-ValueType
EFh 13 41 6.91e-5 SMART
EFh 53 76 4.45e1 SMART
Meta Mutation Damage Score 0.2366 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Plastins are a family of actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. In humans, two ubiquitous plastin isoforms (L and T) have been identified. Plastin 1 (otherwise known as Fimbrin) is a third distinct plastin isoform which is specifically expressed at high levels in the small intestine. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). However, L-plastin has been found in many types of malignant human cells of non-hemopoietic origin suggesting that its expression is induced accompanying tumorigenesis in solid tissues. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to S. aureus infection, defective neutrophil killing of S. aureus, and impaired adhesion-dependent respiratory bursts in neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T C 19: 21,575,609 (GRCm39) probably benign Het
Apoh G A 11: 108,298,288 (GRCm39) R196Q probably benign Het
Arnt C T 3: 95,355,704 (GRCm39) S16L possibly damaging Het
B4galnt4 T C 7: 140,644,761 (GRCm39) F194L probably benign Het
BC034090 A T 1: 155,100,972 (GRCm39) L431M possibly damaging Het
Bdh2 G T 3: 134,994,040 (GRCm39) A31S probably damaging Het
Brd10 C T 19: 29,694,075 (GRCm39) S1873N possibly damaging Het
Cacna1s T C 1: 136,046,833 (GRCm39) S1821P probably benign Het
Caskin1 A T 17: 24,725,824 (GRCm39) Q1370L possibly damaging Het
Ccdc83 T A 7: 89,893,362 (GRCm39) S132C probably damaging Het
Cdk15 A T 1: 59,370,110 (GRCm39) H384L probably damaging Het
Col24a1 T C 3: 145,020,691 (GRCm39) I354T probably benign Het
Coro7 T C 16: 4,451,620 (GRCm39) I451V probably benign Het
Ctnna2 T C 6: 77,735,483 (GRCm39) E65G probably damaging Het
Ctsll3 A T 13: 60,948,162 (GRCm39) W172R probably benign Het
D630045J12Rik T C 6: 38,145,078 (GRCm39) D1316G probably damaging Het
Ddx19b C T 8: 111,734,890 (GRCm39) A493T probably benign Het
Ddx4 C T 13: 112,736,547 (GRCm39) V608I probably damaging Het
Ddx4 T A 13: 112,757,276 (GRCm39) H348L probably damaging Het
Dnah17 G C 11: 117,995,361 (GRCm39) Q996E probably benign Het
Dnah9 G C 11: 65,739,197 (GRCm39) N4180K probably damaging Het
Dok7 A G 5: 35,234,610 (GRCm39) probably null Het
Dpf3 T A 12: 83,371,809 (GRCm39) probably null Het
Efcab3 A G 11: 104,637,090 (GRCm39) I988M probably damaging Het
Elfn1 G C 5: 139,958,604 (GRCm39) R536P probably damaging Het
Eml6 A G 11: 29,783,075 (GRCm39) V602A probably benign Het
Enpp2 T C 15: 54,746,378 (GRCm39) D296G probably damaging Het
Evi5 A T 5: 107,896,230 (GRCm39) F738I probably benign Het
Eya2 T C 2: 165,558,039 (GRCm39) S212P probably benign Het
Fam83a T C 15: 57,849,498 (GRCm39) L14P probably damaging Het
Fanca A T 8: 124,014,803 (GRCm39) M735K probably benign Het
Fancm T A 12: 65,148,466 (GRCm39) S694T probably benign Het
Fibcd1 G A 2: 31,706,673 (GRCm39) T386I probably damaging Het
Foxd4 A G 19: 24,877,178 (GRCm39) S341P probably benign Het
Foxp4 C T 17: 48,186,796 (GRCm39) R378Q unknown Het
Fryl A T 5: 73,255,609 (GRCm39) S807R probably benign Het
Fscb T C 12: 64,520,008 (GRCm39) E486G unknown Het
Galnt17 A G 5: 131,179,782 (GRCm39) S122P probably benign Het
Ghitm A G 14: 36,853,586 (GRCm39) F85L probably benign Het
Ghrh C A 2: 157,175,386 (GRCm39) V32L probably benign Het
Gli2 C T 1: 118,765,430 (GRCm39) R907H probably benign Het
Gm28042 A G 2: 119,872,096 (GRCm39) *1015W probably null Het
Gpr179 T C 11: 97,228,784 (GRCm39) T1124A probably benign Het
Grid2 C A 6: 63,885,902 (GRCm39) C99* probably null Het
Grin1 A T 2: 25,187,927 (GRCm39) M523K probably benign Het
Gucy2g T C 19: 55,211,328 (GRCm39) Y634C possibly damaging Het
Gucy2g T G 19: 55,221,485 (GRCm39) T339P probably benign Het
Haus6 A T 4: 86,522,483 (GRCm39) L116H probably damaging Het
Hey1 T C 3: 8,731,879 (GRCm39) T18A probably benign Het
Hipk3 T C 2: 104,264,186 (GRCm39) N792D probably damaging Het
Il19 A T 1: 130,866,893 (GRCm39) L29Q probably damaging Het
Il21r A G 7: 125,228,144 (GRCm39) Q205R probably damaging Het
Kcnip2 T C 19: 45,782,122 (GRCm39) D169G probably null Het
Kctd18 T C 1: 58,006,779 (GRCm39) I24V probably benign Het
Lig3 G C 11: 82,686,544 (GRCm39) D642H probably benign Het
Lrba A G 3: 86,515,696 (GRCm39) K2166E probably damaging Het
Lrrn2 T C 1: 132,866,972 (GRCm39) V679A probably benign Het
Lyst G A 13: 13,904,929 (GRCm39) R3202H probably damaging Het
Micall2 A G 5: 139,721,885 (GRCm39) C11R probably damaging Het
Morc2b T G 17: 33,356,065 (GRCm39) Q569P probably benign Het
Mtrf1 A G 14: 79,639,111 (GRCm39) E81G probably damaging Het
Myh2 G T 11: 67,080,004 (GRCm39) S1099I possibly damaging Het
Nap1l1 T A 10: 111,326,914 (GRCm39) D158E probably benign Het
Nckap5l T A 15: 99,320,699 (GRCm39) T1285S probably damaging Het
Nsrp1 A T 11: 76,936,612 (GRCm39) M528K probably damaging Het
Numa1 C T 7: 101,658,529 (GRCm39) A1605V probably damaging Het
Nutm2 T C 13: 50,627,878 (GRCm39) L453P probably damaging Het
Ofd1 T C X: 165,210,210 (GRCm39) Y205C probably benign Het
Or2ag12 T A 7: 106,276,877 (GRCm39) N272I probably damaging Het
Or2n1c A G 17: 38,519,355 (GRCm39) Y73C probably damaging Het
Or4c125 T A 2: 89,170,640 (GRCm39) N2I probably damaging Het
Or52k2 A T 7: 102,253,777 (GRCm39) D72V probably damaging Het
Or7a40 T A 16: 16,491,447 (GRCm39) M133L probably benign Het
Patl1 T C 19: 11,898,782 (GRCm39) L159P probably benign Het
Paxip1 G A 5: 27,949,134 (GRCm39) T1045I probably damaging Het
Phaf1 T A 8: 105,973,132 (GRCm39) D247E possibly damaging Het
Pik3ca A G 3: 32,505,903 (GRCm39) probably null Het
Pkhd1 T A 1: 20,451,747 (GRCm39) I2183F probably damaging Het
Plec C T 15: 76,073,372 (GRCm39) R319H probably damaging Het
Pnkd G A 1: 74,391,008 (GRCm39) G334D probably damaging Het
Prss50 A G 9: 110,691,449 (GRCm39) Y251C probably damaging Het
Rab11b A T 17: 33,979,209 (GRCm39) Y10N probably damaging Het
Rfc1 G A 5: 65,476,867 (GRCm39) R4W probably damaging Het
Rgs19 A T 2: 181,331,276 (GRCm39) F119Y probably damaging Het
Safb A G 17: 56,912,821 (GRCm39) H883R probably benign Het
Serpine1 G A 5: 137,096,601 (GRCm39) Q227* probably null Het
Slc25a13 A G 6: 6,096,668 (GRCm39) probably null Het
Slc6a18 T A 13: 73,812,308 (GRCm39) T502S possibly damaging Het
Sox4 T C 13: 29,136,631 (GRCm39) D125G probably damaging Het
Spata31d1e T C 13: 59,890,599 (GRCm39) D407G probably damaging Het
Stag3 C T 5: 138,298,400 (GRCm39) T731I probably damaging Het
Thada G T 17: 84,617,470 (GRCm39) P1349T probably damaging Het
Tmem245 C A 4: 56,937,964 (GRCm39) V195F probably benign Het
Tnxb A G 17: 34,898,055 (GRCm39) H901R probably benign Het
Trim39 A T 17: 36,579,645 (GRCm39) D103E probably benign Het
Ttn A T 2: 76,562,304 (GRCm39) V28847E probably damaging Het
Tubb1 A T 2: 174,297,484 (GRCm39) D31V possibly damaging Het
Ush1g A G 11: 115,209,280 (GRCm39) S305P probably damaging Het
Vmn1r191 A T 13: 22,362,952 (GRCm39) N267K possibly damaging Het
Vmn1r59 A T 7: 5,457,038 (GRCm39) Y241N probably damaging Het
Vmn2r49 T C 7: 9,720,235 (GRCm39) N419D probably damaging Het
Vps35 T C 8: 86,005,623 (GRCm39) D326G possibly damaging Het
Xdh A G 17: 74,199,746 (GRCm39) S1187P possibly damaging Het
Xpc A C 6: 91,478,007 (GRCm39) probably null Het
Zfp273 T C 13: 67,973,282 (GRCm39) Y104H probably damaging Het
Other mutations in Lcp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Lcp1 APN 14 75,464,533 (GRCm39) critical splice donor site probably null
IGL01768:Lcp1 APN 14 75,461,573 (GRCm39) missense probably benign 0.40
IGL01801:Lcp1 APN 14 75,436,815 (GRCm39) missense probably benign 0.10
IGL01940:Lcp1 APN 14 75,453,805 (GRCm39) missense probably benign 0.17
IGL02135:Lcp1 APN 14 75,437,926 (GRCm39) missense probably benign 0.00
IGL02185:Lcp1 APN 14 75,466,740 (GRCm39) missense possibly damaging 0.73
IGL02478:Lcp1 APN 14 75,461,536 (GRCm39) missense probably benign 0.04
IGL02604:Lcp1 APN 14 75,461,566 (GRCm39) missense probably benign 0.11
R0244:Lcp1 UTSW 14 75,464,441 (GRCm39) missense possibly damaging 0.92
R0295:Lcp1 UTSW 14 75,436,860 (GRCm39) missense probably null 0.59
R0313:Lcp1 UTSW 14 75,436,873 (GRCm39) missense probably damaging 1.00
R0415:Lcp1 UTSW 14 75,464,446 (GRCm39) missense possibly damaging 0.88
R0751:Lcp1 UTSW 14 75,436,827 (GRCm39) missense probably benign 0.00
R0811:Lcp1 UTSW 14 75,451,928 (GRCm39) missense probably benign 0.00
R0812:Lcp1 UTSW 14 75,451,928 (GRCm39) missense probably benign 0.00
R1200:Lcp1 UTSW 14 75,466,742 (GRCm39) missense possibly damaging 0.73
R1713:Lcp1 UTSW 14 75,436,884 (GRCm39) critical splice donor site probably null
R1915:Lcp1 UTSW 14 75,436,737 (GRCm39) missense possibly damaging 0.81
R1970:Lcp1 UTSW 14 75,437,946 (GRCm39) missense probably damaging 1.00
R1971:Lcp1 UTSW 14 75,437,946 (GRCm39) missense probably damaging 1.00
R2045:Lcp1 UTSW 14 75,437,841 (GRCm39) missense probably benign 0.01
R2064:Lcp1 UTSW 14 75,435,515 (GRCm39) critical splice acceptor site probably null
R3949:Lcp1 UTSW 14 75,443,569 (GRCm39) missense possibly damaging 0.68
R4062:Lcp1 UTSW 14 75,452,620 (GRCm39) missense probably damaging 1.00
R4521:Lcp1 UTSW 14 75,452,608 (GRCm39) missense possibly damaging 0.94
R4811:Lcp1 UTSW 14 75,437,848 (GRCm39) missense probably damaging 0.99
R4854:Lcp1 UTSW 14 75,437,929 (GRCm39) missense probably damaging 1.00
R4974:Lcp1 UTSW 14 75,445,911 (GRCm39) nonsense probably null
R5539:Lcp1 UTSW 14 75,466,738 (GRCm39) missense probably benign 0.08
R5561:Lcp1 UTSW 14 75,449,948 (GRCm39) missense probably benign 0.01
R5724:Lcp1 UTSW 14 75,464,422 (GRCm39) missense probably benign 0.18
R5989:Lcp1 UTSW 14 75,436,827 (GRCm39) missense probably benign 0.00
R6731:Lcp1 UTSW 14 75,443,629 (GRCm39) missense probably damaging 1.00
R7346:Lcp1 UTSW 14 75,447,946 (GRCm39) missense possibly damaging 0.49
R7670:Lcp1 UTSW 14 75,437,871 (GRCm39) missense probably benign 0.12
R7698:Lcp1 UTSW 14 75,443,651 (GRCm39) nonsense probably null
R9780:Lcp1 UTSW 14 75,440,178 (GRCm39) missense probably damaging 1.00
S24628:Lcp1 UTSW 14 75,464,446 (GRCm39) missense possibly damaging 0.88
X0027:Lcp1 UTSW 14 75,464,526 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGGCAAGAGGATTTGGGGTTT -3'
(R):5'- CATCCAGGTGGGTGTGCTTG -3'

Sequencing Primer
(F):5'- CTGGAACTCACTTTGTAGACCAGG -3'
(R):5'- GTGCTTGCTTCTTTGCTTTTAGC -3'
Posted On 2014-08-25