Incidental Mutation 'R2010:Rb1'
ID219564
Institutional Source Beutler Lab
Gene Symbol Rb1
Ensembl Gene ENSMUSG00000022105
Gene NameRB transcriptional corepressor 1
SynonymsRb-1, Rb, pRb
MMRRC Submission 040019-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2010 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location73183673-73325822 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73294993 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 134 (T134A)
Ref Sequence ENSEMBL: ENSMUSP00000022701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022701] [ENSMUST00000164624]
Predicted Effect probably benign
Transcript: ENSMUST00000022701
AA Change: T134A

PolyPhen 2 Score 0.155 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000022701
Gene: ENSMUSG00000022105
AA Change: T134A

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 37 53 N/A INTRINSIC
DUF3452 97 223 4.59e-25 SMART
RB_A 367 567 5.53e-92 SMART
CYCLIN 653 740 1.62e-5 SMART
Rb_C 761 920 1.28e-96 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164624
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a negative regulator of the cell cycle and was the first tumor suppressor gene found. The encoded protein also stabilizes constitutive heterochromatin to maintain the overall chromatin structure. The active, hypophosphorylated form of the protein binds transcription factor E2F1. Defects in this gene are a cause of childhood cancer retinoblastoma (RB), bladder cancer, and osteogenic sarcoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted mutations exhibit abnormalities of the neuronal and hematopoietic systems and die in utero. Heterozygotes may develop pituitary tumors associated with loss of the normal allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik G A 3: 36,481,806 G74S unknown Het
4930452B06Rik A T 14: 8,511,021 F464L probably damaging Het
4932438A13Rik T G 3: 36,928,551 N788K probably benign Het
Aimp1 A T 3: 132,667,492 L229Q probably benign Het
Arhgef6 T C X: 57,299,505 T52A possibly damaging Het
Aste1 C A 9: 105,403,502 H25Q probably damaging Het
Atp13a1 G A 8: 69,791,360 G36R possibly damaging Het
Bahcc1 T C 11: 120,272,778 V634A probably damaging Het
C1s1 A T 6: 124,537,394 Y168N probably damaging Het
Camsap2 T C 1: 136,274,868 S612G probably damaging Het
Cdh23 C A 10: 60,314,227 R2611L probably damaging Het
Cilp2 A G 8: 69,881,694 Y885H probably damaging Het
D430042O09Rik A G 7: 125,872,956 I1544M possibly damaging Het
Dhrs3 C T 4: 144,927,188 T227I possibly damaging Het
Dnah2 A T 11: 69,458,358 probably null Het
Dnah3 T G 7: 120,095,177 M1L probably benign Het
Ehbp1l1 A G 19: 5,719,283 I664T probably benign Het
Eif4e C T 3: 138,555,458 T171I probably benign Het
Elfn1 C T 5: 139,973,316 R692W probably damaging Het
Eps8l3 T A 3: 107,879,372 M1K probably null Het
Evi5 C A 5: 107,813,545 probably null Het
Fancd2 A T 6: 113,593,291 D1401V probably damaging Het
Fat2 G A 11: 55,253,827 R4074C probably damaging Het
Fkbp4 A T 6: 128,435,802 V55E probably benign Het
Fnip1 A G 11: 54,482,503 D180G probably damaging Het
Galc A G 12: 98,254,230 F126S possibly damaging Het
Gdf7 C T 12: 8,301,729 V69M unknown Het
Glis2 A G 16: 4,608,711 E22G probably damaging Het
Hist1h2bb G A 13: 23,747,128 V112M possibly damaging Het
Hps4 T A 5: 112,369,476 V243E probably damaging Het
Ighe T A 12: 113,271,488 I351F unknown Het
Irak4 A T 15: 94,551,806 R55S probably damaging Het
Itpr2 G A 6: 146,227,524 probably null Het
Kirrel3 T C 9: 34,939,198 Y41H probably damaging Het
Krr1 A G 10: 111,975,569 E56G possibly damaging Het
Lgi1 G A 19: 38,301,235 V250I probably damaging Het
Lipf A G 19: 33,973,546 N306D probably benign Het
Lman2l C T 1: 36,445,181 W18* probably null Het
Lztfl1 T A 9: 123,702,186 N239I possibly damaging Het
Mief1 T C 15: 80,247,925 S66P possibly damaging Het
Mmp8 C A 9: 7,567,534 S465* probably null Het
Muc2 A T 7: 141,700,875 T208S probably damaging Het
Myh8 A T 11: 67,297,164 K921* probably null Het
Myh9 T C 15: 77,771,947 E1121G probably benign Het
Nbn T C 4: 15,969,393 S213P probably damaging Het
Nol10 A G 12: 17,416,101 E499G probably benign Het
Nxn T C 11: 76,398,801 E87G probably damaging Het
Olfr293 A G 7: 86,664,603 T314A probably benign Het
Olfr568 T A 7: 102,877,685 C188* probably null Het
Olfr937 T C 9: 39,060,099 H189R probably benign Het
Pds5b CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 5: 150,775,354 probably benign Het
Pigk A G 3: 152,766,514 I354M probably damaging Het
Pigl T A 11: 62,458,682 C75S probably damaging Het
Pm20d1 T A 1: 131,812,114 I400N probably benign Het
Prkg2 T A 5: 99,024,805 H17L probably benign Het
Psmd1 T A 1: 86,075,997 L168Q probably damaging Het
Rab3gap2 A T 1: 185,278,281 H1136L possibly damaging Het
Rims1 T C 1: 22,296,996 E1024G probably damaging Het
Rrp12 A G 19: 41,872,937 V977A probably benign Het
Rusc2 C T 4: 43,415,212 P173S probably benign Het
Selenov A T 7: 28,288,022 D310E probably damaging Het
Serpina3f T A 12: 104,217,323 L148Q probably damaging Het
Slc10a1 C T 12: 80,960,447 V187I probably benign Het
Spsb2 A G 6: 124,810,376 K258E probably damaging Het
Tas2r105 A C 6: 131,687,402 V21G probably benign Het
Tmem229b-ps T A 10: 53,475,199 noncoding transcript Het
Tnrc6a C G 7: 123,171,046 H686Q probably benign Het
Trpc2 T A 7: 102,094,573 F715L probably benign Het
Ube2t T A 1: 134,969,298 I56N probably benign Het
Ubr4 T C 4: 139,480,652 Y4915H possibly damaging Het
Usp32 T A 11: 85,040,004 E533D probably damaging Het
Vipr2 T G 12: 116,122,810 probably null Het
Vmn1r15 A G 6: 57,258,284 T46A probably benign Het
Vmn1r203 T G 13: 22,524,447 S133A possibly damaging Het
Vmn1r215 T G 13: 23,076,208 N139K probably damaging Het
Vmn1r232 C T 17: 20,913,339 R333H probably benign Het
Wdr20rt C A 12: 65,227,214 H311N possibly damaging Het
Zranb1 T C 7: 132,966,696 probably null Het
Other mutations in Rb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Rb1 APN 14 73264598 missense probably damaging 1.00
IGL00951:Rb1 APN 14 73322072 missense probably damaging 1.00
IGL01152:Rb1 APN 14 73205870 missense probably damaging 1.00
IGL01339:Rb1 APN 14 73264371 critical splice acceptor site probably null
IGL01349:Rb1 APN 14 73269118 missense probably damaging 1.00
IGL01390:Rb1 APN 14 73294999 missense probably benign 0.02
IGL02066:Rb1 APN 14 73198534 missense probably benign 0.06
IGL02207:Rb1 APN 14 73206085 missense probably damaging 1.00
IGL02860:Rb1 APN 14 73206012 missense probably damaging 1.00
IGL03370:Rb1 APN 14 73282866 critical splice donor site probably null
rubidium UTSW 14 73199311 missense probably damaging 1.00
P0028:Rb1 UTSW 14 73264628 missense probably damaging 1.00
R0553:Rb1 UTSW 14 73211712 nonsense probably null
R0563:Rb1 UTSW 14 73216767 missense probably damaging 1.00
R0586:Rb1 UTSW 14 73287684 intron probably benign
R0595:Rb1 UTSW 14 73273680 missense probably damaging 1.00
R0755:Rb1 UTSW 14 73197213 makesense probably null
R1480:Rb1 UTSW 14 73262602 missense probably benign
R1513:Rb1 UTSW 14 73322084 missense probably benign 0.00
R1752:Rb1 UTSW 14 73287624 missense probably damaging 0.99
R1919:Rb1 UTSW 14 73212990 nonsense probably null
R2087:Rb1 UTSW 14 73280252 missense probably benign 0.09
R2152:Rb1 UTSW 14 73288725 missense probably benign
R2167:Rb1 UTSW 14 73211651 missense probably damaging 1.00
R3950:Rb1 UTSW 14 73262662 missense probably damaging 1.00
R4183:Rb1 UTSW 14 73198526 splice site probably null
R4225:Rb1 UTSW 14 73269191 missense possibly damaging 0.58
R4306:Rb1 UTSW 14 73262695 missense probably damaging 1.00
R4464:Rb1 UTSW 14 73199198 intron probably null
R4609:Rb1 UTSW 14 73262514 splice site probably benign
R4671:Rb1 UTSW 14 73273676 missense probably damaging 1.00
R4916:Rb1 UTSW 14 73216691 missense probably damaging 1.00
R5160:Rb1 UTSW 14 73264455 synonymous silent
R5210:Rb1 UTSW 14 73199311 missense probably damaging 1.00
R5320:Rb1 UTSW 14 73213126 nonsense probably null
R5436:Rb1 UTSW 14 73213140 splice site probably null
R5467:Rb1 UTSW 14 73211620 missense possibly damaging 0.92
R5592:Rb1 UTSW 14 73211747 missense probably damaging 1.00
R6326:Rb1 UTSW 14 73198534 missense probably benign 0.06
R6363:Rb1 UTSW 14 73287641 missense probably benign 0.01
R6395:Rb1 UTSW 14 73199196 missense probably damaging 1.00
R6414:Rb1 UTSW 14 73282974 missense unknown
R6460:Rb1 UTSW 14 73278454 missense probably benign 0.06
R6503:Rb1 UTSW 14 73205880 missense probably benign 0.08
R6519:Rb1 UTSW 14 73298063 missense probably benign 0.00
R6671:Rb1 UTSW 14 73197266 missense probably damaging 1.00
R7026:Rb1 UTSW 14 73298099 missense probably benign 0.00
R7103:Rb1 UTSW 14 73262644 missense probably damaging 1.00
R7263:Rb1 UTSW 14 73282923 nonsense probably null
R7478:Rb1 UTSW 14 73269137 missense probably damaging 1.00
R7519:Rb1 UTSW 14 73264608 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTAGGGGATAATGCTTAATAC -3'
(R):5'- ATACTAGGGCCTGGGTTGCTTC -3'

Sequencing Primer
(F):5'- ACTTCTATTACCCATGACAGTTTCC -3'
(R):5'- GCCTGGGTTGCTTCTAATAAAATGC -3'
Posted On2014-08-25