Incidental Mutation 'R2010:Glis2'
ID219574
Institutional Source Beutler Lab
Gene Symbol Glis2
Ensembl Gene ENSMUSG00000014303
Gene NameGLIS family zinc finger 2
SynonymsNkl
MMRRC Submission 040019-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.910) question?
Stock #R2010 (G1)
Quality Score146
Status Not validated
Chromosome16
Chromosomal Location4594713-4624924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4608711 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 22 (E22G)
Ref Sequence ENSEMBL: ENSMUSP00000115728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014447] [ENSMUST00000141682]
Predicted Effect probably damaging
Transcript: ENSMUST00000014447
AA Change: E22G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000014447
Gene: ENSMUSG00000014303
AA Change: E22G

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
low complexity region 74 100 N/A INTRINSIC
ZnF_C2H2 168 193 1.05e1 SMART
ZnF_C2H2 202 229 8.09e0 SMART
ZnF_C2H2 235 257 1.82e-3 SMART
ZnF_C2H2 263 287 3.16e-3 SMART
ZnF_C2H2 293 317 1.04e-3 SMART
low complexity region 328 342 N/A INTRINSIC
low complexity region 358 385 N/A INTRINSIC
low complexity region 387 402 N/A INTRINSIC
low complexity region 405 418 N/A INTRINSIC
low complexity region 420 445 N/A INTRINSIC
low complexity region 468 475 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122896
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127120
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135577
Predicted Effect probably damaging
Transcript: ENSMUST00000141682
AA Change: E22G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115728
Gene: ENSMUSG00000014303
AA Change: E22G

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
low complexity region 74 100 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the GLI-similar zinc finger protein family and encodes a nuclear transcription factor with five C2H2-type zinc finger domains. The protein encoded by this gene is widely expressed at low levels in the neural tube and peripheral nervous system and likely promotes neuronal differentiation. It is abundantly expressed in the kidney and may have a role in the regulation of kidney morphogenesis. p120 regulates the expression level of this protein and induces the cleavage of this protein's C-terminal zinc finger domain. This protein also promotes the nuclear translocation of p120. Mutations in this gene cause nephronophthisis (NPHP), an autosomal recessive kidney disease characterized by tubular basement membrane disruption, interstitial lymphohistiocytic cell infiltration, and development of cysts at the corticomedullary border of the kidneys.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a fusion allele exhibit decreased kidney weight, kidney atrophy, kidney cysts, and interstitial fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik G A 3: 36,481,806 G74S unknown Het
4930452B06Rik A T 14: 8,511,021 F464L probably damaging Het
4932438A13Rik T G 3: 36,928,551 N788K probably benign Het
Aimp1 A T 3: 132,667,492 L229Q probably benign Het
Arhgef6 T C X: 57,299,505 T52A possibly damaging Het
Aste1 C A 9: 105,403,502 H25Q probably damaging Het
Atp13a1 G A 8: 69,791,360 G36R possibly damaging Het
Bahcc1 T C 11: 120,272,778 V634A probably damaging Het
C1s1 A T 6: 124,537,394 Y168N probably damaging Het
Camsap2 T C 1: 136,274,868 S612G probably damaging Het
Cdh23 C A 10: 60,314,227 R2611L probably damaging Het
Cilp2 A G 8: 69,881,694 Y885H probably damaging Het
D430042O09Rik A G 7: 125,872,956 I1544M possibly damaging Het
Dhrs3 C T 4: 144,927,188 T227I possibly damaging Het
Dnah2 A T 11: 69,458,358 probably null Het
Dnah3 T G 7: 120,095,177 M1L probably benign Het
Ehbp1l1 A G 19: 5,719,283 I664T probably benign Het
Eif4e C T 3: 138,555,458 T171I probably benign Het
Elfn1 C T 5: 139,973,316 R692W probably damaging Het
Eps8l3 T A 3: 107,879,372 M1K probably null Het
Evi5 C A 5: 107,813,545 probably null Het
Fancd2 A T 6: 113,593,291 D1401V probably damaging Het
Fat2 G A 11: 55,253,827 R4074C probably damaging Het
Fkbp4 A T 6: 128,435,802 V55E probably benign Het
Fnip1 A G 11: 54,482,503 D180G probably damaging Het
Galc A G 12: 98,254,230 F126S possibly damaging Het
Gdf7 C T 12: 8,301,729 V69M unknown Het
Hist1h2bb G A 13: 23,747,128 V112M possibly damaging Het
Hps4 T A 5: 112,369,476 V243E probably damaging Het
Ighe T A 12: 113,271,488 I351F unknown Het
Irak4 A T 15: 94,551,806 R55S probably damaging Het
Itpr2 G A 6: 146,227,524 probably null Het
Kirrel3 T C 9: 34,939,198 Y41H probably damaging Het
Krr1 A G 10: 111,975,569 E56G possibly damaging Het
Lgi1 G A 19: 38,301,235 V250I probably damaging Het
Lipf A G 19: 33,973,546 N306D probably benign Het
Lman2l C T 1: 36,445,181 W18* probably null Het
Lztfl1 T A 9: 123,702,186 N239I possibly damaging Het
Mief1 T C 15: 80,247,925 S66P possibly damaging Het
Mmp8 C A 9: 7,567,534 S465* probably null Het
Muc2 A T 7: 141,700,875 T208S probably damaging Het
Myh8 A T 11: 67,297,164 K921* probably null Het
Myh9 T C 15: 77,771,947 E1121G probably benign Het
Nbn T C 4: 15,969,393 S213P probably damaging Het
Nol10 A G 12: 17,416,101 E499G probably benign Het
Nxn T C 11: 76,398,801 E87G probably damaging Het
Olfr293 A G 7: 86,664,603 T314A probably benign Het
Olfr568 T A 7: 102,877,685 C188* probably null Het
Olfr937 T C 9: 39,060,099 H189R probably benign Het
Pds5b CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 5: 150,775,354 probably benign Het
Pigk A G 3: 152,766,514 I354M probably damaging Het
Pigl T A 11: 62,458,682 C75S probably damaging Het
Pm20d1 T A 1: 131,812,114 I400N probably benign Het
Prkg2 T A 5: 99,024,805 H17L probably benign Het
Psmd1 T A 1: 86,075,997 L168Q probably damaging Het
Rab3gap2 A T 1: 185,278,281 H1136L possibly damaging Het
Rb1 T C 14: 73,294,993 T134A probably benign Het
Rims1 T C 1: 22,296,996 E1024G probably damaging Het
Rrp12 A G 19: 41,872,937 V977A probably benign Het
Rusc2 C T 4: 43,415,212 P173S probably benign Het
Selenov A T 7: 28,288,022 D310E probably damaging Het
Serpina3f T A 12: 104,217,323 L148Q probably damaging Het
Slc10a1 C T 12: 80,960,447 V187I probably benign Het
Spsb2 A G 6: 124,810,376 K258E probably damaging Het
Tas2r105 A C 6: 131,687,402 V21G probably benign Het
Tmem229b-ps T A 10: 53,475,199 noncoding transcript Het
Tnrc6a C G 7: 123,171,046 H686Q probably benign Het
Trpc2 T A 7: 102,094,573 F715L probably benign Het
Ube2t T A 1: 134,969,298 I56N probably benign Het
Ubr4 T C 4: 139,480,652 Y4915H possibly damaging Het
Usp32 T A 11: 85,040,004 E533D probably damaging Het
Vipr2 T G 12: 116,122,810 probably null Het
Vmn1r15 A G 6: 57,258,284 T46A probably benign Het
Vmn1r203 T G 13: 22,524,447 S133A possibly damaging Het
Vmn1r215 T G 13: 23,076,208 N139K probably damaging Het
Vmn1r232 C T 17: 20,913,339 R333H probably benign Het
Wdr20rt C A 12: 65,227,214 H311N possibly damaging Het
Zranb1 T C 7: 132,966,696 probably null Het
Other mutations in Glis2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Glis2 APN 16 4611650 missense probably damaging 1.00
IGL01680:Glis2 APN 16 4611331 missense possibly damaging 0.82
IGL02055:Glis2 APN 16 4614108 unclassified probably benign
IGL02802:Glis2 UTSW 16 4611871 critical splice donor site probably null
R0081:Glis2 UTSW 16 4613653 missense probably benign 0.22
R0517:Glis2 UTSW 16 4611552 missense probably damaging 0.98
R2145:Glis2 UTSW 16 4613642 missense possibly damaging 0.79
R3780:Glis2 UTSW 16 4613896 unclassified probably benign
R4180:Glis2 UTSW 16 4611376 missense probably benign 0.04
R5213:Glis2 UTSW 16 4614082 unclassified probably benign
R6012:Glis2 UTSW 16 4611308 missense possibly damaging 0.76
R6052:Glis2 UTSW 16 4613739 unclassified probably benign
R6214:Glis2 UTSW 16 4610333 nonsense probably null
R6215:Glis2 UTSW 16 4610333 nonsense probably null
R6316:Glis2 UTSW 16 4613836 unclassified probably benign
R7172:Glis2 UTSW 16 4613475 missense probably benign 0.32
R7286:Glis2 UTSW 16 4611318 missense possibly damaging 0.93
R7346:Glis2 UTSW 16 4613568 missense possibly damaging 0.83
R7816:Glis2 UTSW 16 4613464 missense probably damaging 1.00
X0020:Glis2 UTSW 16 4608653 missense probably damaging 1.00
X0027:Glis2 UTSW 16 4611457 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GACTCTCCAGGATGCCAGTAAG -3'
(R):5'- CTTCCTGTTGGGCACACATG -3'

Sequencing Primer
(F):5'- TCTGCTCCCAGAAGTTTCAATGGG -3'
(R):5'- ACACATGGCGCAGTCCC -3'
Posted On2014-08-25