Incidental Mutation 'R1969:Xdh'
ID 219577
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Name xanthine dehydrogenase
Synonyms Xox-1, XO, Xor, Xox1, xanthine oxidase
MMRRC Submission 039982-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.430) question?
Stock # R1969 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 74190890-74257191 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 74199746 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1187 (S1187P)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
AlphaFold Q00519
Predicted Effect possibly damaging
Transcript: ENSMUST00000024866
AA Change: S1187P

PolyPhen 2 Score 0.554 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: S1187P

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 105 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T C 19: 21,575,609 (GRCm39) probably benign Het
Apoh G A 11: 108,298,288 (GRCm39) R196Q probably benign Het
Arnt C T 3: 95,355,704 (GRCm39) S16L possibly damaging Het
B4galnt4 T C 7: 140,644,761 (GRCm39) F194L probably benign Het
BC034090 A T 1: 155,100,972 (GRCm39) L431M possibly damaging Het
Bdh2 G T 3: 134,994,040 (GRCm39) A31S probably damaging Het
Brd10 C T 19: 29,694,075 (GRCm39) S1873N possibly damaging Het
Cacna1s T C 1: 136,046,833 (GRCm39) S1821P probably benign Het
Caskin1 A T 17: 24,725,824 (GRCm39) Q1370L possibly damaging Het
Ccdc83 T A 7: 89,893,362 (GRCm39) S132C probably damaging Het
Cdk15 A T 1: 59,370,110 (GRCm39) H384L probably damaging Het
Col24a1 T C 3: 145,020,691 (GRCm39) I354T probably benign Het
Coro7 T C 16: 4,451,620 (GRCm39) I451V probably benign Het
Ctnna2 T C 6: 77,735,483 (GRCm39) E65G probably damaging Het
Ctsll3 A T 13: 60,948,162 (GRCm39) W172R probably benign Het
D630045J12Rik T C 6: 38,145,078 (GRCm39) D1316G probably damaging Het
Ddx19b C T 8: 111,734,890 (GRCm39) A493T probably benign Het
Ddx4 C T 13: 112,736,547 (GRCm39) V608I probably damaging Het
Ddx4 T A 13: 112,757,276 (GRCm39) H348L probably damaging Het
Dnah17 G C 11: 117,995,361 (GRCm39) Q996E probably benign Het
Dnah9 G C 11: 65,739,197 (GRCm39) N4180K probably damaging Het
Dok7 A G 5: 35,234,610 (GRCm39) probably null Het
Dpf3 T A 12: 83,371,809 (GRCm39) probably null Het
Efcab3 A G 11: 104,637,090 (GRCm39) I988M probably damaging Het
Elfn1 G C 5: 139,958,604 (GRCm39) R536P probably damaging Het
Eml6 A G 11: 29,783,075 (GRCm39) V602A probably benign Het
Enpp2 T C 15: 54,746,378 (GRCm39) D296G probably damaging Het
Evi5 A T 5: 107,896,230 (GRCm39) F738I probably benign Het
Eya2 T C 2: 165,558,039 (GRCm39) S212P probably benign Het
Fam83a T C 15: 57,849,498 (GRCm39) L14P probably damaging Het
Fanca A T 8: 124,014,803 (GRCm39) M735K probably benign Het
Fancm T A 12: 65,148,466 (GRCm39) S694T probably benign Het
Fibcd1 G A 2: 31,706,673 (GRCm39) T386I probably damaging Het
Foxd4 A G 19: 24,877,178 (GRCm39) S341P probably benign Het
Foxp4 C T 17: 48,186,796 (GRCm39) R378Q unknown Het
Fryl A T 5: 73,255,609 (GRCm39) S807R probably benign Het
Fscb T C 12: 64,520,008 (GRCm39) E486G unknown Het
Galnt17 A G 5: 131,179,782 (GRCm39) S122P probably benign Het
Ghitm A G 14: 36,853,586 (GRCm39) F85L probably benign Het
Ghrh C A 2: 157,175,386 (GRCm39) V32L probably benign Het
Gli2 C T 1: 118,765,430 (GRCm39) R907H probably benign Het
Gm28042 A G 2: 119,872,096 (GRCm39) *1015W probably null Het
Gpr179 T C 11: 97,228,784 (GRCm39) T1124A probably benign Het
Grid2 C A 6: 63,885,902 (GRCm39) C99* probably null Het
Grin1 A T 2: 25,187,927 (GRCm39) M523K probably benign Het
Gucy2g T C 19: 55,211,328 (GRCm39) Y634C possibly damaging Het
Gucy2g T G 19: 55,221,485 (GRCm39) T339P probably benign Het
Haus6 A T 4: 86,522,483 (GRCm39) L116H probably damaging Het
Hey1 T C 3: 8,731,879 (GRCm39) T18A probably benign Het
Hipk3 T C 2: 104,264,186 (GRCm39) N792D probably damaging Het
Il19 A T 1: 130,866,893 (GRCm39) L29Q probably damaging Het
Il21r A G 7: 125,228,144 (GRCm39) Q205R probably damaging Het
Kcnip2 T C 19: 45,782,122 (GRCm39) D169G probably null Het
Kctd18 T C 1: 58,006,779 (GRCm39) I24V probably benign Het
Lcp1 T C 14: 75,437,946 (GRCm39) S119P probably damaging Het
Lig3 G C 11: 82,686,544 (GRCm39) D642H probably benign Het
Lrba A G 3: 86,515,696 (GRCm39) K2166E probably damaging Het
Lrrn2 T C 1: 132,866,972 (GRCm39) V679A probably benign Het
Lyst G A 13: 13,904,929 (GRCm39) R3202H probably damaging Het
Micall2 A G 5: 139,721,885 (GRCm39) C11R probably damaging Het
Morc2b T G 17: 33,356,065 (GRCm39) Q569P probably benign Het
Mtrf1 A G 14: 79,639,111 (GRCm39) E81G probably damaging Het
Myh2 G T 11: 67,080,004 (GRCm39) S1099I possibly damaging Het
Nap1l1 T A 10: 111,326,914 (GRCm39) D158E probably benign Het
Nckap5l T A 15: 99,320,699 (GRCm39) T1285S probably damaging Het
Nsrp1 A T 11: 76,936,612 (GRCm39) M528K probably damaging Het
Numa1 C T 7: 101,658,529 (GRCm39) A1605V probably damaging Het
Nutm2 T C 13: 50,627,878 (GRCm39) L453P probably damaging Het
Ofd1 T C X: 165,210,210 (GRCm39) Y205C probably benign Het
Or2ag12 T A 7: 106,276,877 (GRCm39) N272I probably damaging Het
Or2n1c A G 17: 38,519,355 (GRCm39) Y73C probably damaging Het
Or4c125 T A 2: 89,170,640 (GRCm39) N2I probably damaging Het
Or52k2 A T 7: 102,253,777 (GRCm39) D72V probably damaging Het
Or7a40 T A 16: 16,491,447 (GRCm39) M133L probably benign Het
Patl1 T C 19: 11,898,782 (GRCm39) L159P probably benign Het
Paxip1 G A 5: 27,949,134 (GRCm39) T1045I probably damaging Het
Phaf1 T A 8: 105,973,132 (GRCm39) D247E possibly damaging Het
Pik3ca A G 3: 32,505,903 (GRCm39) probably null Het
Pkhd1 T A 1: 20,451,747 (GRCm39) I2183F probably damaging Het
Plec C T 15: 76,073,372 (GRCm39) R319H probably damaging Het
Pnkd G A 1: 74,391,008 (GRCm39) G334D probably damaging Het
Prss50 A G 9: 110,691,449 (GRCm39) Y251C probably damaging Het
Rab11b A T 17: 33,979,209 (GRCm39) Y10N probably damaging Het
Rfc1 G A 5: 65,476,867 (GRCm39) R4W probably damaging Het
Rgs19 A T 2: 181,331,276 (GRCm39) F119Y probably damaging Het
Safb A G 17: 56,912,821 (GRCm39) H883R probably benign Het
Serpine1 G A 5: 137,096,601 (GRCm39) Q227* probably null Het
Slc25a13 A G 6: 6,096,668 (GRCm39) probably null Het
Slc6a18 T A 13: 73,812,308 (GRCm39) T502S possibly damaging Het
Sox4 T C 13: 29,136,631 (GRCm39) D125G probably damaging Het
Spata31d1e T C 13: 59,890,599 (GRCm39) D407G probably damaging Het
Stag3 C T 5: 138,298,400 (GRCm39) T731I probably damaging Het
Thada G T 17: 84,617,470 (GRCm39) P1349T probably damaging Het
Tmem245 C A 4: 56,937,964 (GRCm39) V195F probably benign Het
Tnxb A G 17: 34,898,055 (GRCm39) H901R probably benign Het
Trim39 A T 17: 36,579,645 (GRCm39) D103E probably benign Het
Ttn A T 2: 76,562,304 (GRCm39) V28847E probably damaging Het
Tubb1 A T 2: 174,297,484 (GRCm39) D31V possibly damaging Het
Ush1g A G 11: 115,209,280 (GRCm39) S305P probably damaging Het
Vmn1r191 A T 13: 22,362,952 (GRCm39) N267K possibly damaging Het
Vmn1r59 A T 7: 5,457,038 (GRCm39) Y241N probably damaging Het
Vmn2r49 T C 7: 9,720,235 (GRCm39) N419D probably damaging Het
Vps35 T C 8: 86,005,623 (GRCm39) D326G possibly damaging Het
Xpc A C 6: 91,478,007 (GRCm39) probably null Het
Zfp273 T C 13: 67,973,282 (GRCm39) Y104H probably damaging Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 74,230,101 (GRCm39) missense possibly damaging 0.58
IGL00556:Xdh APN 17 74,191,430 (GRCm39) makesense probably null
IGL01524:Xdh APN 17 74,230,132 (GRCm39) critical splice acceptor site probably null
IGL01604:Xdh APN 17 74,216,332 (GRCm39) missense probably benign 0.02
IGL01625:Xdh APN 17 74,223,781 (GRCm39) critical splice donor site probably null
IGL01778:Xdh APN 17 74,207,275 (GRCm39) missense probably benign 0.00
IGL01804:Xdh APN 17 74,199,754 (GRCm39) missense probably damaging 1.00
IGL01825:Xdh APN 17 74,198,240 (GRCm39) missense probably damaging 1.00
IGL01929:Xdh APN 17 74,241,850 (GRCm39) missense probably damaging 1.00
IGL02068:Xdh APN 17 74,220,945 (GRCm39) missense probably damaging 1.00
IGL02079:Xdh APN 17 74,198,272 (GRCm39) missense probably damaging 1.00
IGL02210:Xdh APN 17 74,250,890 (GRCm39) missense probably benign 0.00
IGL02261:Xdh APN 17 74,220,960 (GRCm39) missense possibly damaging 0.81
IGL02365:Xdh APN 17 74,250,885 (GRCm39) missense probably benign 0.14
IGL02424:Xdh APN 17 74,233,565 (GRCm39) missense probably benign 0.00
IGL02491:Xdh APN 17 74,193,459 (GRCm39) missense probably damaging 0.99
IGL02525:Xdh APN 17 74,231,990 (GRCm39) missense possibly damaging 0.91
IGL02578:Xdh APN 17 74,213,241 (GRCm39) missense probably damaging 1.00
IGL02793:Xdh APN 17 74,207,576 (GRCm39) missense probably damaging 1.00
IGL02939:Xdh APN 17 74,250,840 (GRCm39) critical splice donor site probably null
IGL03327:Xdh APN 17 74,223,787 (GRCm39) missense probably benign
IGL03345:Xdh APN 17 74,213,027 (GRCm39) missense probably damaging 0.98
IGL03353:Xdh APN 17 74,202,781 (GRCm39) missense possibly damaging 0.65
inky UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
nucleus UTSW 17 74,206,007 (GRCm39) nonsense probably null
squidgame UTSW 17 74,246,831 (GRCm39) missense probably benign
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0018:Xdh UTSW 17 74,232,020 (GRCm39) missense probably benign 0.00
R0033:Xdh UTSW 17 74,214,627 (GRCm39) missense probably benign 0.06
R0079:Xdh UTSW 17 74,198,213 (GRCm39) missense probably damaging 1.00
R0086:Xdh UTSW 17 74,191,433 (GRCm39) missense probably benign
R0319:Xdh UTSW 17 74,213,096 (GRCm39) splice site probably benign
R0336:Xdh UTSW 17 74,229,458 (GRCm39) missense possibly damaging 0.91
R0389:Xdh UTSW 17 74,205,357 (GRCm39) missense probably damaging 1.00
R0684:Xdh UTSW 17 74,250,886 (GRCm39) missense probably damaging 0.97
R0930:Xdh UTSW 17 74,230,077 (GRCm39) missense probably benign 0.00
R1073:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R1114:Xdh UTSW 17 74,248,144 (GRCm39) splice site probably benign
R1201:Xdh UTSW 17 74,225,413 (GRCm39) missense probably benign 0.05
R1230:Xdh UTSW 17 74,198,251 (GRCm39) missense probably damaging 1.00
R1351:Xdh UTSW 17 74,230,073 (GRCm39) missense probably benign 0.02
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1470:Xdh UTSW 17 74,198,107 (GRCm39) missense probably damaging 1.00
R1485:Xdh UTSW 17 74,221,014 (GRCm39) nonsense probably null
R1548:Xdh UTSW 17 74,220,896 (GRCm39) missense probably damaging 0.98
R1637:Xdh UTSW 17 74,207,573 (GRCm39) missense probably benign
R1641:Xdh UTSW 17 74,233,547 (GRCm39) missense probably benign
R1758:Xdh UTSW 17 74,217,204 (GRCm39) missense probably damaging 1.00
R1951:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R2024:Xdh UTSW 17 74,228,300 (GRCm39) missense possibly damaging 0.92
R2080:Xdh UTSW 17 74,216,320 (GRCm39) missense probably damaging 1.00
R2157:Xdh UTSW 17 74,229,532 (GRCm39) missense probably damaging 1.00
R2300:Xdh UTSW 17 74,198,260 (GRCm39) missense probably damaging 1.00
R3783:Xdh UTSW 17 74,200,590 (GRCm39) splice site probably benign
R3796:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3797:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3798:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3799:Xdh UTSW 17 74,214,653 (GRCm39) missense probably damaging 1.00
R3819:Xdh UTSW 17 74,213,720 (GRCm39) missense probably benign 0.35
R4085:Xdh UTSW 17 74,223,874 (GRCm39) missense probably benign 0.35
R4240:Xdh UTSW 17 74,202,790 (GRCm39) missense possibly damaging 0.72
R4356:Xdh UTSW 17 74,222,685 (GRCm39) missense probably benign 0.01
R4522:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4523:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4524:Xdh UTSW 17 74,205,339 (GRCm39) missense probably damaging 1.00
R4600:Xdh UTSW 17 74,217,195 (GRCm39) missense probably benign 0.19
R4617:Xdh UTSW 17 74,225,389 (GRCm39) missense probably damaging 0.99
R4756:Xdh UTSW 17 74,193,381 (GRCm39) missense probably benign 0.24
R4761:Xdh UTSW 17 74,217,262 (GRCm39) missense possibly damaging 0.91
R4815:Xdh UTSW 17 74,213,210 (GRCm39) missense probably damaging 1.00
R4850:Xdh UTSW 17 74,205,330 (GRCm39) missense probably damaging 1.00
R4896:Xdh UTSW 17 74,217,238 (GRCm39) missense probably damaging 0.96
R4897:Xdh UTSW 17 74,207,703 (GRCm39) missense probably benign
R4923:Xdh UTSW 17 74,231,931 (GRCm39) missense possibly damaging 0.72
R4977:Xdh UTSW 17 74,205,965 (GRCm39) missense probably benign 0.05
R5030:Xdh UTSW 17 74,198,288 (GRCm39) missense probably damaging 1.00
R5185:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R5347:Xdh UTSW 17 74,232,027 (GRCm39) missense probably benign
R5556:Xdh UTSW 17 74,204,759 (GRCm39) missense probably benign 0.21
R5566:Xdh UTSW 17 74,200,617 (GRCm39) missense probably damaging 1.00
R5568:Xdh UTSW 17 74,250,880 (GRCm39) missense possibly damaging 0.90
R5635:Xdh UTSW 17 74,220,870 (GRCm39) missense possibly damaging 0.92
R5662:Xdh UTSW 17 74,248,110 (GRCm39) missense probably damaging 0.99
R5955:Xdh UTSW 17 74,205,315 (GRCm39) missense probably damaging 1.00
R6058:Xdh UTSW 17 74,213,264 (GRCm39) missense probably damaging 1.00
R6061:Xdh UTSW 17 74,228,342 (GRCm39) missense probably damaging 1.00
R6412:Xdh UTSW 17 74,242,902 (GRCm39) missense probably benign 0.09
R6526:Xdh UTSW 17 74,207,546 (GRCm39) missense probably damaging 0.97
R6558:Xdh UTSW 17 74,200,708 (GRCm39) missense possibly damaging 0.95
R6843:Xdh UTSW 17 74,230,125 (GRCm39) missense probably damaging 1.00
R6932:Xdh UTSW 17 74,229,557 (GRCm39) missense probably damaging 0.99
R7028:Xdh UTSW 17 74,250,868 (GRCm39) missense probably damaging 0.99
R7418:Xdh UTSW 17 74,220,960 (GRCm39) missense possibly damaging 0.81
R7503:Xdh UTSW 17 74,233,205 (GRCm39) missense probably damaging 1.00
R7653:Xdh UTSW 17 74,204,040 (GRCm39) missense probably benign 0.10
R7763:Xdh UTSW 17 74,241,829 (GRCm39) missense possibly damaging 0.69
R7768:Xdh UTSW 17 74,246,831 (GRCm39) missense probably benign
R7904:Xdh UTSW 17 74,229,467 (GRCm39) missense probably benign 0.09
R8010:Xdh UTSW 17 74,216,312 (GRCm39) nonsense probably null
R8067:Xdh UTSW 17 74,207,652 (GRCm39) missense probably benign 0.01
R8238:Xdh UTSW 17 74,193,412 (GRCm39) missense probably benign
R8253:Xdh UTSW 17 74,225,377 (GRCm39) missense possibly damaging 0.94
R8346:Xdh UTSW 17 74,220,938 (GRCm39) missense probably damaging 1.00
R8350:Xdh UTSW 17 74,241,837 (GRCm39) missense probably damaging 1.00
R8381:Xdh UTSW 17 74,219,456 (GRCm39) missense probably benign
R8427:Xdh UTSW 17 74,242,926 (GRCm39) missense probably damaging 1.00
R8465:Xdh UTSW 17 74,206,007 (GRCm39) nonsense probably null
R8478:Xdh UTSW 17 74,213,053 (GRCm39) missense probably benign 0.00
R8680:Xdh UTSW 17 74,229,500 (GRCm39) missense probably benign
R8802:Xdh UTSW 17 74,225,405 (GRCm39) missense probably benign 0.00
R8984:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8985:Xdh UTSW 17 74,228,346 (GRCm39) missense probably damaging 1.00
R8995:Xdh UTSW 17 74,205,369 (GRCm39) missense probably damaging 1.00
R9035:Xdh UTSW 17 74,217,222 (GRCm39) missense probably benign
R9149:Xdh UTSW 17 74,222,688 (GRCm39) missense probably benign
R9181:Xdh UTSW 17 74,232,006 (GRCm39) missense probably damaging 1.00
R9357:Xdh UTSW 17 74,233,541 (GRCm39) critical splice donor site probably null
R9357:Xdh UTSW 17 74,214,711 (GRCm39) missense probably damaging 0.97
R9609:Xdh UTSW 17 74,231,990 (GRCm39) missense possibly damaging 0.91
R9803:Xdh UTSW 17 74,229,455 (GRCm39) missense probably benign
X0019:Xdh UTSW 17 74,225,449 (GRCm39) missense probably damaging 1.00
Z1088:Xdh UTSW 17 74,193,423 (GRCm39) missense probably benign
Z1176:Xdh UTSW 17 74,230,037 (GRCm39) critical splice donor site probably null
Z1177:Xdh UTSW 17 74,204,690 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAGTACTATGCTCTGGCC -3'
(R):5'- TGCATTTAACTCGGTTGCTAAGATC -3'

Sequencing Primer
(F):5'- GCTCTGGCCTGCTTAAAAACAATG -3'
(R):5'- CGGTTGCTAAGATCTCAAATGTCAGC -3'
Posted On 2014-08-25