Incidental Mutation 'R1969:Gucy2g'
ID219594
Institutional Source Beutler Lab
Gene Symbol Gucy2g
Ensembl Gene ENSMUSG00000055523
Gene Nameguanylate cyclase 2g
SynonymsGC-G, 2410077I05Rik
MMRRC Submission 039982-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1969 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location55198297-55241236 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55222896 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 634 (Y634C)
Ref Sequence ENSEMBL: ENSMUSP00000068253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069183]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069183
AA Change: Y634C

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000068253
Gene: ENSMUSG00000055523
AA Change: Y634C

DomainStartEndE-ValueType
low complexity region 27 38 N/A INTRINSIC
Pfam:ANF_receptor 65 416 5.2e-36 PFAM
low complexity region 471 487 N/A INTRINSIC
Pfam:Pkinase 574 826 2e-26 PFAM
Pfam:Pkinase_Tyr 577 826 6e-35 PFAM
CYCc 865 1059 6.42e-96 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation are viable and fertile with no gross abnormalities and are protected against acute ischemia induced renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110059E24Rik T C 19: 21,598,245 probably benign Het
1700014D04Rik T C 13: 59,742,785 D407G probably damaging Het
9930021J03Rik C T 19: 29,716,675 S1873N possibly damaging Het
Apoh G A 11: 108,407,462 R196Q probably benign Het
Arnt C T 3: 95,448,393 S16L possibly damaging Het
B4galnt4 T C 7: 141,064,848 F194L probably benign Het
BC034090 A T 1: 155,225,226 L431M possibly damaging Het
Bdh2 G T 3: 135,288,279 A31S probably damaging Het
Cacna1s T C 1: 136,119,095 S1821P probably benign Het
Caskin1 A T 17: 24,506,850 Q1370L possibly damaging Het
Ccdc83 T A 7: 90,244,154 S132C probably damaging Het
Cdk15 A T 1: 59,330,951 H384L probably damaging Het
Col24a1 T C 3: 145,314,930 I354T probably benign Het
Coro7 T C 16: 4,633,756 I451V probably benign Het
Ctnna2 T C 6: 77,758,500 E65G probably damaging Het
Ctsll3 A T 13: 60,800,348 W172R probably benign Het
D230025D16Rik T A 8: 105,246,500 D247E possibly damaging Het
D630045J12Rik T C 6: 38,168,143 D1316G probably damaging Het
Ddx19b C T 8: 111,008,258 A493T probably benign Het
Ddx4 C T 13: 112,600,013 V608I probably damaging Het
Ddx4 T A 13: 112,620,742 H348L probably damaging Het
Dnah17 G C 11: 118,104,535 Q996E probably benign Het
Dnah9 G C 11: 65,848,371 N4180K probably damaging Het
Dok7 A G 5: 35,077,266 probably null Het
Dpf3 T A 12: 83,325,035 probably null Het
Elfn1 G C 5: 139,972,849 R536P probably damaging Het
Eml6 A G 11: 29,833,075 V602A probably benign Het
Enpp2 T C 15: 54,882,982 D296G probably damaging Het
Evi5 A T 5: 107,748,364 F738I probably benign Het
Eya2 T C 2: 165,716,119 S212P probably benign Het
Fam83a T C 15: 57,986,102 L14P probably damaging Het
Fanca A T 8: 123,288,064 M735K probably benign Het
Fancm T A 12: 65,101,692 S694T probably benign Het
Fibcd1 G A 2: 31,816,661 T386I probably damaging Het
Foxd4 A G 19: 24,899,814 S341P probably benign Het
Foxp4 C T 17: 47,875,871 R378Q unknown Het
Fryl A T 5: 73,098,266 S807R probably benign Het
Fscb T C 12: 64,473,234 E486G unknown Het
Galnt17 A G 5: 131,150,944 S122P probably benign Het
Ghitm A G 14: 37,131,629 F85L probably benign Het
Ghrh C A 2: 157,333,466 V32L probably benign Het
Gli2 C T 1: 118,837,700 R907H probably benign Het
Gm11639 A G 11: 104,746,264 I988M probably damaging Het
Gm28042 A G 2: 120,041,615 *1015W probably null Het
Gpr179 T C 11: 97,337,958 T1124A probably benign Het
Grid2 C A 6: 63,908,918 C99* probably null Het
Grin1 A T 2: 25,297,915 M523K probably benign Het
Haus6 A T 4: 86,604,246 L116H probably damaging Het
Hey1 T C 3: 8,666,819 T18A probably benign Het
Hipk3 T C 2: 104,433,841 N792D probably damaging Het
Il19 A T 1: 130,939,156 L29Q probably damaging Het
Il21r A G 7: 125,628,972 Q205R probably damaging Het
Kcnip2 T C 19: 45,793,683 D169G probably null Het
Kctd18 T C 1: 57,967,620 I24V probably benign Het
Lcp1 T C 14: 75,200,506 S119P probably damaging Het
Lig3 G C 11: 82,795,718 D642H probably benign Het
Lrba A G 3: 86,608,389 K2166E probably damaging Het
Lrrn2 T C 1: 132,939,234 V679A probably benign Het
Lyst G A 13: 13,730,344 R3202H probably damaging Het
Micall2 A G 5: 139,736,130 C11R probably damaging Het
Morc2b T G 17: 33,137,091 Q569P probably benign Het
Mtrf1 A G 14: 79,401,671 E81G probably damaging Het
Myh2 G T 11: 67,189,178 S1099I possibly damaging Het
Nap1l1 T A 10: 111,491,053 D158E probably benign Het
Nckap5l T A 15: 99,422,818 T1285S probably damaging Het
Nsrp1 A T 11: 77,045,786 M528K probably damaging Het
Numa1 C T 7: 102,009,322 A1605V probably damaging Het
Nutm2 T C 13: 50,473,842 L453P probably damaging Het
Ofd1 T C X: 166,427,214 Y205C probably benign Het
Olfr1233 T A 2: 89,340,296 N2I probably damaging Het
Olfr135 A G 17: 38,208,464 Y73C probably damaging Het
Olfr19 T A 16: 16,673,583 M133L probably benign Het
Olfr552 A T 7: 102,604,570 D72V probably damaging Het
Olfr693 T A 7: 106,677,670 N272I probably damaging Het
Patl1 T C 19: 11,921,418 L159P probably benign Het
Paxip1 G A 5: 27,744,136 T1045I probably damaging Het
Pik3ca A G 3: 32,451,754 probably null Het
Pkhd1 T A 1: 20,381,523 I2183F probably damaging Het
Plec C T 15: 76,189,172 R319H probably damaging Het
Pnkd G A 1: 74,351,849 G334D probably damaging Het
Prss50 A G 9: 110,862,381 Y251C probably damaging Het
Rab11b A T 17: 33,760,235 Y10N probably damaging Het
Rfc1 G A 5: 65,319,524 R4W probably damaging Het
Rgs19 A T 2: 181,689,483 F119Y probably damaging Het
Safb A G 17: 56,605,821 H883R probably benign Het
Serpine1 G A 5: 137,067,747 Q227* probably null Het
Slc25a13 A G 6: 6,096,668 probably null Het
Slc6a18 T A 13: 73,664,189 T502S possibly damaging Het
Sox4 T C 13: 28,952,648 D125G probably damaging Het
Stag3 C T 5: 138,300,138 T731I probably damaging Het
Thada G T 17: 84,310,042 P1349T probably damaging Het
Tmem245 C A 4: 56,937,964 V195F probably benign Het
Tnxb A G 17: 34,679,081 H901R probably benign Het
Trim39 A T 17: 36,268,753 D103E probably benign Het
Ttn A T 2: 76,731,960 V28847E probably damaging Het
Tubb1 A T 2: 174,455,691 D31V possibly damaging Het
Ush1g A G 11: 115,318,454 S305P probably damaging Het
Vmn1r191 A T 13: 22,178,782 N267K possibly damaging Het
Vmn1r59 A T 7: 5,454,039 Y241N probably damaging Het
Vmn2r49 T C 7: 9,986,308 N419D probably damaging Het
Vps35 T C 8: 85,278,994 D326G possibly damaging Het
Xdh A G 17: 73,892,751 S1187P possibly damaging Het
Xpc A C 6: 91,501,025 probably null Het
Zfp273 T C 13: 67,825,163 Y104H probably damaging Het
Other mutations in Gucy2g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Gucy2g APN 19 55233103 missense probably benign 0.01
IGL01954:Gucy2g APN 19 55198691 missense probably benign 0.01
IGL01969:Gucy2g APN 19 55227438 missense probably benign 0.00
IGL02164:Gucy2g APN 19 55238023 missense probably benign
IGL02534:Gucy2g APN 19 55241068 missense probably damaging 1.00
IGL02667:Gucy2g APN 19 55206177 missense possibly damaging 0.64
IGL02755:Gucy2g APN 19 55210354 missense probably benign 0.10
IGL03187:Gucy2g APN 19 55231052 missense possibly damaging 0.91
IGL03354:Gucy2g APN 19 55233080 missense possibly damaging 0.95
PIT4366001:Gucy2g UTSW 19 55237782 missense probably null 0.51
R0040:Gucy2g UTSW 19 55217302 missense possibly damaging 0.73
R0126:Gucy2g UTSW 19 55241166 missense probably benign
R0318:Gucy2g UTSW 19 55237798 missense probably benign 0.00
R0576:Gucy2g UTSW 19 55198770 missense probably damaging 1.00
R0604:Gucy2g UTSW 19 55203087 missense probably benign 0.00
R0962:Gucy2g UTSW 19 55210284 nonsense probably null
R1348:Gucy2g UTSW 19 55222906 missense possibly damaging 0.68
R1458:Gucy2g UTSW 19 55215036 splice site probably benign
R1693:Gucy2g UTSW 19 55222926 missense probably damaging 1.00
R1795:Gucy2g UTSW 19 55199541 missense probably damaging 1.00
R1804:Gucy2g UTSW 19 55210309 missense probably benign 0.34
R1830:Gucy2g UTSW 19 55222930 missense possibly damaging 0.94
R1902:Gucy2g UTSW 19 55210237 missense probably benign 0.20
R1927:Gucy2g UTSW 19 55237759 missense probably benign 0.02
R1969:Gucy2g UTSW 19 55233053 missense probably benign 0.42
R2071:Gucy2g UTSW 19 55222340 missense possibly damaging 0.72
R2842:Gucy2g UTSW 19 55240947 missense probably damaging 1.00
R2971:Gucy2g UTSW 19 55210276 missense probably damaging 1.00
R4202:Gucy2g UTSW 19 55229769 missense possibly damaging 0.96
R4405:Gucy2g UTSW 19 55237837 missense probably benign 0.08
R4407:Gucy2g UTSW 19 55237837 missense probably benign 0.08
R4614:Gucy2g UTSW 19 55202147 nonsense probably null
R4671:Gucy2g UTSW 19 55238068 missense probably damaging 1.00
R4684:Gucy2g UTSW 19 55206256 missense probably damaging 1.00
R4837:Gucy2g UTSW 19 55226053 missense probably benign
R4969:Gucy2g UTSW 19 55226013 missense probably benign
R5050:Gucy2g UTSW 19 55240935 missense probably benign 0.05
R5059:Gucy2g UTSW 19 55226071 missense probably benign 0.00
R5070:Gucy2g UTSW 19 55229787 missense probably damaging 0.98
R5288:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5384:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5386:Gucy2g UTSW 19 55215116 missense probably damaging 1.00
R5497:Gucy2g UTSW 19 55198701 missense probably benign 0.00
R5531:Gucy2g UTSW 19 55241140 missense probably benign 0.24
R5536:Gucy2g UTSW 19 55237927 missense probably benign 0.05
R5679:Gucy2g UTSW 19 55231079 missense possibly damaging 0.87
R5715:Gucy2g UTSW 19 55233155 missense possibly damaging 0.93
R5941:Gucy2g UTSW 19 55215131 missense probably damaging 1.00
R6250:Gucy2g UTSW 19 55217424 missense probably damaging 0.99
R6288:Gucy2g UTSW 19 55227513 missense probably benign 0.01
R6378:Gucy2g UTSW 19 55240945 missense probably benign 0.00
R6605:Gucy2g UTSW 19 55241028 missense probably damaging 1.00
R7020:Gucy2g UTSW 19 55233050 missense probably damaging 0.98
R7064:Gucy2g UTSW 19 55210332 missense probably benign 0.01
R7078:Gucy2g UTSW 19 55241151 missense probably damaging 1.00
R7402:Gucy2g UTSW 19 55206293 missense probably damaging 1.00
R7539:Gucy2g UTSW 19 55203154 missense probably damaging 0.99
R7561:Gucy2g UTSW 19 55206340 missense probably benign 0.38
R7583:Gucy2g UTSW 19 55235615 missense probably damaging 1.00
R7804:Gucy2g UTSW 19 55228152 missense probably benign 0.02
R7880:Gucy2g UTSW 19 55206280 missense probably damaging 1.00
Z1177:Gucy2g UTSW 19 55210377 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCATAGAGTTTCCACCCAGAGC -3'
(R):5'- CTTCACAGCACCTTAGGAATTAACTC -3'

Sequencing Primer
(F):5'- AGTTTCCACCCAGAGCAGAGG -3'
(R):5'- CACCTTAGGAATTAACTCAACGTGGG -3'
Posted On2014-08-25