Incidental Mutation 'R2011:Spen'
ID219647
Institutional Source Beutler Lab
Gene Symbol Spen
Ensembl Gene ENSMUSG00000040761
Gene Namespen family transcription repressor
SynonymsMint
MMRRC Submission 040020-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2011 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location141467890-141538597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 141473329 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 2662 (N2662K)
Ref Sequence ENSEMBL: ENSMUSP00000101412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078886] [ENSMUST00000105786]
Predicted Effect probably damaging
Transcript: ENSMUST00000078886
AA Change: N2639K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077925
Gene: ENSMUSG00000040761
AA Change: N2639K

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 617 632 N/A INTRINSIC
low complexity region 669 691 N/A INTRINSIC
low complexity region 695 720 N/A INTRINSIC
low complexity region 749 773 N/A INTRINSIC
coiled coil region 800 825 N/A INTRINSIC
low complexity region 830 841 N/A INTRINSIC
internal_repeat_2 844 954 6.27e-5 PROSPERO
coiled coil region 1494 1522 N/A INTRINSIC
low complexity region 1587 1627 N/A INTRINSIC
low complexity region 1635 1641 N/A INTRINSIC
low complexity region 1642 1671 N/A INTRINSIC
low complexity region 1747 1758 N/A INTRINSIC
low complexity region 1810 1823 N/A INTRINSIC
low complexity region 1888 1903 N/A INTRINSIC
low complexity region 1940 1955 N/A INTRINSIC
low complexity region 2003 2012 N/A INTRINSIC
internal_repeat_2 2015 2115 6.27e-5 PROSPERO
low complexity region 2127 2147 N/A INTRINSIC
low complexity region 2169 2191 N/A INTRINSIC
low complexity region 2207 2219 N/A INTRINSIC
low complexity region 2304 2323 N/A INTRINSIC
low complexity region 2332 2371 N/A INTRINSIC
low complexity region 2396 2413 N/A INTRINSIC
low complexity region 2518 2533 N/A INTRINSIC
low complexity region 2545 2555 N/A INTRINSIC
low complexity region 2696 2722 N/A INTRINSIC
low complexity region 2931 2942 N/A INTRINSIC
low complexity region 2994 3006 N/A INTRINSIC
low complexity region 3192 3212 N/A INTRINSIC
low complexity region 3299 3337 N/A INTRINSIC
Pfam:SPOC 3465 3586 2.7e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105786
AA Change: N2662K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101412
Gene: ENSMUSG00000040761
AA Change: N2662K

DomainStartEndE-ValueType
RRM 7 77 7.77e-12 SMART
low complexity region 109 121 N/A INTRINSIC
low complexity region 235 257 N/A INTRINSIC
low complexity region 262 311 N/A INTRINSIC
RRM 338 411 8.6e-5 SMART
RRM 441 511 1.56e-16 SMART
RRM 520 587 1.84e-13 SMART
low complexity region 692 714 N/A INTRINSIC
low complexity region 718 743 N/A INTRINSIC
low complexity region 772 796 N/A INTRINSIC
coiled coil region 823 848 N/A INTRINSIC
low complexity region 853 864 N/A INTRINSIC
internal_repeat_2 867 977 8.58e-5 PROSPERO
coiled coil region 1517 1545 N/A INTRINSIC
low complexity region 1610 1650 N/A INTRINSIC
low complexity region 1658 1664 N/A INTRINSIC
low complexity region 1665 1694 N/A INTRINSIC
low complexity region 1770 1781 N/A INTRINSIC
low complexity region 1833 1846 N/A INTRINSIC
low complexity region 1911 1926 N/A INTRINSIC
low complexity region 1963 1978 N/A INTRINSIC
low complexity region 2026 2035 N/A INTRINSIC
internal_repeat_2 2038 2138 8.58e-5 PROSPERO
low complexity region 2150 2170 N/A INTRINSIC
low complexity region 2192 2214 N/A INTRINSIC
low complexity region 2230 2242 N/A INTRINSIC
low complexity region 2327 2346 N/A INTRINSIC
low complexity region 2355 2394 N/A INTRINSIC
low complexity region 2419 2436 N/A INTRINSIC
low complexity region 2541 2556 N/A INTRINSIC
low complexity region 2568 2578 N/A INTRINSIC
low complexity region 2719 2745 N/A INTRINSIC
low complexity region 2954 2965 N/A INTRINSIC
low complexity region 3017 3029 N/A INTRINSIC
low complexity region 3215 3235 N/A INTRINSIC
low complexity region 3322 3360 N/A INTRINSIC
Pfam:SPOC 3488 3609 2.7e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147227
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hormone inducible transcriptional repressor. Repression of transcription by this gene product can occur through interactions with other repressors, by the recruitment of proteins involved in histone deacetylation, or through sequestration of transcriptional activators. The product of this gene contains a carboxy-terminal domain that permits binding to other corepressor proteins. This domain also permits interaction with members of the NuRD complex, a nucleosome remodeling protein complex that contains deacetylase activity. In addition, this repressor contains several RNA recognition motifs that confer binding to a steroid receptor RNA coactivator; this binding can modulate the activity of both liganded and nonliganded steroid receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die during late gestation exhibiting morphological abnormalities of the heart, pancreas, and liver. Inactivation of this gene also affects the differentiation of B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T G 10: 100,583,958 D58A probably damaging Het
Abhd6 A T 14: 8,042,742 T100S probably benign Het
Adam6a T C 12: 113,545,378 I457T probably benign Het
Aff3 T C 1: 38,207,915 N863S probably benign Het
Agk C A 6: 40,376,234 D177E probably benign Het
Alg9 C T 9: 50,788,200 A209V probably damaging Het
Arl6 A T 16: 59,624,313 I51K probably damaging Het
Bpi A T 2: 158,261,352 H89L probably damaging Het
C1qtnf1 T A 11: 118,448,284 F260Y probably benign Het
Cblc T A 7: 19,784,822 D452V probably benign Het
Ccar1 T C 10: 62,776,694 T231A probably benign Het
Ccdc112 A G 18: 46,287,432 L417P probably damaging Het
Ccdc144b A T 3: 36,010,678 C515* probably null Het
Ccdc34 G A 2: 110,044,304 R336Q possibly damaging Het
CK137956 A G 4: 127,951,036 S305P probably benign Het
Clip2 T C 5: 134,503,115 D612G probably damaging Het
Col28a1 T C 6: 8,059,360 T692A probably benign Het
Copg2 A T 6: 30,816,741 probably null Het
Ctnna2 T A 6: 76,973,791 I566F possibly damaging Het
Cux2 C T 5: 121,861,326 D1184N probably benign Het
Dclk3 A G 9: 111,468,354 E322G probably benign Het
Ddx41 A T 13: 55,534,093 probably null Het
Dnaaf2 G A 12: 69,196,785 P107S probably damaging Het
Eif2ak4 A G 2: 118,430,947 E578G probably damaging Het
Exd1 A G 2: 119,528,663 probably benign Het
Fat2 G A 11: 55,282,757 P2377S probably damaging Het
Fbxl18 T C 5: 142,872,459 T741A probably benign Het
Fgr C A 4: 132,997,521 A311E probably damaging Het
Fmo4 T C 1: 162,798,889 T363A probably damaging Het
Fsbp T C 4: 11,584,006 V235A probably benign Het
Gm1110 T A 9: 26,894,258 H366L probably benign Het
Gm43302 T C 5: 105,290,980 N14S probably damaging Het
Gm5422 A G 10: 31,248,768 noncoding transcript Het
Gpr21 A G 2: 37,517,535 E31G probably damaging Het
Gucy1b2 G T 14: 62,408,758 N560K probably damaging Het
Hmcn1 T C 1: 150,677,334 Q2535R probably benign Het
Hnrnpm A T 17: 33,664,624 N264K probably damaging Het
Hyal6 A T 6: 24,734,724 I219L possibly damaging Het
Ifi211 A G 1: 173,907,603 S87P probably damaging Het
Il17rb A T 14: 29,996,840 C428* probably null Het
Iqca T C 1: 90,045,626 N808S probably benign Het
Kcnu1 A G 8: 25,918,442 I94V probably benign Het
Lrba A T 3: 86,310,017 E517V probably damaging Het
Mcidas A G 13: 112,993,981 E37G possibly damaging Het
Med23 T A 10: 24,879,755 F83L possibly damaging Het
Micu2 T C 14: 57,954,133 probably null Het
Mrgprx2 A T 7: 48,482,534 C179S probably damaging Het
Myo6 A G 9: 80,307,722 T1236A probably damaging Het
Myo7a A T 7: 98,054,708 V1946E possibly damaging Het
Nek10 A T 14: 14,885,122 Y695F probably damaging Het
Nr3c2 A T 8: 76,909,793 I508F possibly damaging Het
Olfr1056 A T 2: 86,356,186 H65Q possibly damaging Het
Olfr1133 A T 2: 87,645,889 I78N probably damaging Het
Olfr12 T C 1: 92,620,749 V281A probably benign Het
Olfr307 A T 7: 86,335,747 Y216* probably null Het
Olfr695 T C 7: 106,873,427 I273V probably benign Het
Olfr743 T C 14: 50,533,684 S91P probably damaging Het
Oxct1 T C 15: 4,153,761 S485P probably benign Het
Oxt A G 2: 130,576,652 D61G probably damaging Het
P2ry10 A C X: 107,102,635 I59L probably damaging Het
Parp11 A G 6: 127,477,891 N124S probably benign Het
Pcdh7 T A 5: 57,719,629 N175K probably damaging Het
Pdgfrb T A 18: 61,061,494 S114R probably benign Het
Pfdn5 A G 15: 102,326,521 N54S possibly damaging Het
Phc2 T A 4: 128,723,585 V468E probably benign Het
Piezo2 T C 18: 63,059,744 T1605A probably damaging Het
Pik3cb A T 9: 99,105,579 Y35* probably null Het
Piwil2 A T 14: 70,426,634 M22K probably damaging Het
Plag1 A G 4: 3,904,889 F101L probably damaging Het
Pomt2 A G 12: 87,111,399 L680P possibly damaging Het
Ppp1r36 A G 12: 76,418,926 probably null Het
Prkag2 C T 5: 24,871,054 probably null Het
Prkg1 T C 19: 31,664,142 D47G possibly damaging Het
Prl6a1 G A 13: 27,315,369 G45D probably benign Het
Rbm20 G A 19: 53,859,428 C1135Y probably damaging Het
Recql5 A T 11: 115,897,097 N465K probably benign Het
Rtcb A T 10: 85,941,933 I459N probably damaging Het
Rtp3 A T 9: 110,986,034 probably benign Het
Rundc3b T A 5: 8,512,409 probably null Het
Scube3 A G 17: 28,168,158 T877A probably damaging Het
Sh2d4a A T 8: 68,346,742 Q421L probably benign Het
Siglec1 A T 2: 131,083,357 Y395N probably damaging Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Slco1c1 T A 6: 141,555,107 F437L probably benign Het
Slco3a1 G A 7: 74,346,671 A329V probably benign Het
Spag9 T A 11: 94,092,375 L504* probably null Het
Sptb G C 12: 76,632,472 R70G possibly damaging Het
Stk3 A G 15: 35,072,498 S136P probably damaging Het
Synj1 A T 16: 90,938,696 F1456L probably damaging Het
Tbx5 T C 5: 119,841,906 probably null Het
Tchh G A 3: 93,446,961 R1236Q unknown Het
Timd4 C A 11: 46,820,030 T253K possibly damaging Het
Tmc6 A G 11: 117,769,406 Y669H probably damaging Het
Tmem151a C T 19: 5,082,938 R80H probably benign Het
Tpgs1 T C 10: 79,675,888 L288P probably damaging Het
Trhde T C 10: 114,498,793 I659V probably benign Het
Trpm7 A T 2: 126,823,997 Y896* probably null Het
Ttc5 C A 14: 50,781,550 E37* probably null Het
Uvrag A G 7: 98,939,889 probably null Het
Vmn1r59 T A 7: 5,454,284 D159V probably damaging Het
Vmn2r78 G A 7: 86,955,079 V822M possibly damaging Het
Vnn1 C A 10: 23,894,971 Y32* probably null Het
Wrn A G 8: 33,236,404 V1380A probably benign Het
Zc3h14 A C 12: 98,780,268 S579R possibly damaging Het
Zfp277 G A 12: 40,317,218 Q480* probably null Het
Zfp456 G A 13: 67,366,874 Q238* probably null Het
Zranb3 T A 1: 128,091,901 T35S probably benign Het
Other mutations in Spen
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:Spen APN 4 141489901 missense unknown
IGL01357:Spen APN 4 141517113 missense unknown
IGL02184:Spen APN 4 141487606 missense unknown
IGL02226:Spen APN 4 141478146 missense unknown
IGL02321:Spen APN 4 141517130 missense unknown
IGL02350:Spen APN 4 141477579 missense unknown
IGL02357:Spen APN 4 141477579 missense unknown
IGL02627:Spen APN 4 141473015 missense probably damaging 0.99
IGL02683:Spen APN 4 141471645 missense probably benign 0.06
IGL02945:Spen APN 4 141494313 missense unknown
IGL02950:Spen APN 4 141469508 missense probably damaging 1.00
IGL03008:Spen APN 4 141476137 missense possibly damaging 0.70
IGL03019:Spen APN 4 141478916 missense unknown
IGL03038:Spen APN 4 141538239 missense unknown
IGL03334:Spen APN 4 141469969 missense probably damaging 1.00
R0105:Spen UTSW 4 141469810 splice site probably benign
R0268:Spen UTSW 4 141477557 missense unknown
R0359:Spen UTSW 4 141516870 missense unknown
R0394:Spen UTSW 4 141474203 missense probably benign 0.03
R0423:Spen UTSW 4 141479336 missense unknown
R0433:Spen UTSW 4 141483758 missense unknown
R0462:Spen UTSW 4 141473651 missense probably damaging 1.00
R0687:Spen UTSW 4 141488028 missense unknown
R0699:Spen UTSW 4 141474391 missense possibly damaging 0.72
R0865:Spen UTSW 4 141471870 missense probably benign 0.11
R0918:Spen UTSW 4 141485564 missense unknown
R1034:Spen UTSW 4 141475752 missense probably benign 0.33
R1341:Spen UTSW 4 141469400 missense possibly damaging 0.78
R1401:Spen UTSW 4 141471821 missense probably damaging 0.98
R1509:Spen UTSW 4 141475635 missense probably benign 0.00
R1509:Spen UTSW 4 141475700 missense possibly damaging 0.53
R1561:Spen UTSW 4 141472383 nonsense probably null
R1589:Spen UTSW 4 141488024 missense unknown
R1640:Spen UTSW 4 141468943 missense probably damaging 0.98
R1758:Spen UTSW 4 141476375 missense unknown
R1764:Spen UTSW 4 141472950 missense probably damaging 1.00
R1824:Spen UTSW 4 141472785 missense probably damaging 1.00
R1899:Spen UTSW 4 141470343 missense probably benign 0.17
R1916:Spen UTSW 4 141472598 missense probably damaging 1.00
R2295:Spen UTSW 4 141477273 missense unknown
R2379:Spen UTSW 4 141516927 missense unknown
R2404:Spen UTSW 4 141477905 missense unknown
R3719:Spen UTSW 4 141517183 missense unknown
R3889:Spen UTSW 4 141477881 missense unknown
R3945:Spen UTSW 4 141477353 missense unknown
R4227:Spen UTSW 4 141522147 missense unknown
R4326:Spen UTSW 4 141477372 missense unknown
R4382:Spen UTSW 4 141473139 missense possibly damaging 0.88
R4542:Spen UTSW 4 141476786 missense unknown
R4757:Spen UTSW 4 141473079 nonsense probably null
R4771:Spen UTSW 4 141472596 missense probably benign 0.14
R5072:Spen UTSW 4 141522302 missense unknown
R5121:Spen UTSW 4 141476099 missense probably benign 0.00
R5176:Spen UTSW 4 141476276 missense unknown
R5290:Spen UTSW 4 141473816 missense probably damaging 1.00
R5291:Spen UTSW 4 141488079 missense unknown
R5293:Spen UTSW 4 141472406 missense possibly damaging 0.89
R5347:Spen UTSW 4 141471485 missense probably benign 0.26
R5511:Spen UTSW 4 141475064 missense possibly damaging 0.86
R5511:Spen UTSW 4 141516838 missense unknown
R5772:Spen UTSW 4 141478184 missense unknown
R5834:Spen UTSW 4 141471843 missense possibly damaging 0.63
R5858:Spen UTSW 4 141473871 missense probably benign 0.05
R6214:Spen UTSW 4 141479112 missense unknown
R6232:Spen UTSW 4 141517022 missense unknown
R6345:Spen UTSW 4 141471633 missense possibly damaging 0.86
R6419:Spen UTSW 4 141476310 missense unknown
R6455:Spen UTSW 4 141475509 missense probably damaging 0.97
R6979:Spen UTSW 4 141478063 missense unknown
R6994:Spen UTSW 4 141493459 missense unknown
R7018:Spen UTSW 4 141493444 missense unknown
R7040:Spen UTSW 4 141494382 missense unknown
R7127:Spen UTSW 4 141476108 missense possibly damaging 0.53
R7218:Spen UTSW 4 141472650 missense possibly damaging 0.54
R7234:Spen UTSW 4 141479135 missense unknown
R7316:Spen UTSW 4 141477054 missense unknown
R7350:Spen UTSW 4 141479385 missense unknown
R7356:Spen UTSW 4 141471924 nonsense probably null
R7400:Spen UTSW 4 141473741 missense probably damaging 1.00
R7470:Spen UTSW 4 141479294 missense unknown
R7698:Spen UTSW 4 141472845 missense probably damaging 1.00
T0722:Spen UTSW 4 141474353 missense probably benign 0.33
T0975:Spen UTSW 4 141474353 missense probably benign 0.33
Z1088:Spen UTSW 4 141477976 missense unknown
Z1088:Spen UTSW 4 141477977 missense unknown
Predicted Primers PCR Primer
(F):5'- CGGCTGTTCTCATTGCTACTGG -3'
(R):5'- ACACAAGCCTCAGAGGTTCC -3'

Sequencing Primer
(F):5'- ATTGCTACTGGCCCGCTG -3'
(R):5'- GGTGGCTGCCGACAAAG -3'
Posted On2014-08-25