Incidental Mutation 'R2011:Tbx5'
ID219658
Institutional Source Beutler Lab
Gene Symbol Tbx5
Ensembl Gene ENSMUSG00000018263
Gene NameT-box 5
Synonyms
MMRRC Submission 040020-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.923) question?
Stock #R2011 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location119832668-119885219 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 119841906 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143828 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018407] [ENSMUST00000202504] [ENSMUST00000202723]
Predicted Effect probably null
Transcript: ENSMUST00000018407
SMART Domains Protein: ENSMUSP00000018407
Gene: ENSMUSG00000018263

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
TBOX 53 243 9.61e-129 SMART
low complexity region 381 392 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202504
SMART Domains Protein: ENSMUSP00000143828
Gene: ENSMUSG00000018263

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
TBOX 53 218 6.3e-100 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202723
SMART Domains Protein: ENSMUSP00000144418
Gene: ENSMUSG00000018263

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
TBOX 53 120 3.1e-9 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of a phylogenetically conserved family of genes that share a common DNA-binding domain, the T-box. T-box genes encode transcription factors involved in the regulation of developmental processes. This gene is closely linked to related family member T-box 3 (ulnar mammary syndrome) on human chromosome 12. The encoded protein may play a role in heart development and specification of limb identity. Mutations in this gene have been associated with Holt-Oram syndrome, a developmental disorder affecting the heart and upper limbs. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Heterozygous null mice exhibit strain-dependent perinatal lethality, forelimb and variable congenital heart malformations, whereas homozygous null mice are growth arrested and die by E10.5 of severe heart defects. Hypomorphic mutants show milder defects both in the hetero- and homozygous null state. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430F08Rik T G 10: 100,583,958 D58A probably damaging Het
Abhd6 A T 14: 8,042,742 T100S probably benign Het
Adam6a T C 12: 113,545,378 I457T probably benign Het
Aff3 T C 1: 38,207,915 N863S probably benign Het
Agk C A 6: 40,376,234 D177E probably benign Het
Alg9 C T 9: 50,788,200 A209V probably damaging Het
Arl6 A T 16: 59,624,313 I51K probably damaging Het
Bpi A T 2: 158,261,352 H89L probably damaging Het
C1qtnf1 T A 11: 118,448,284 F260Y probably benign Het
Cblc T A 7: 19,784,822 D452V probably benign Het
Ccar1 T C 10: 62,776,694 T231A probably benign Het
Ccdc112 A G 18: 46,287,432 L417P probably damaging Het
Ccdc144b A T 3: 36,010,678 C515* probably null Het
Ccdc34 G A 2: 110,044,304 R336Q possibly damaging Het
CK137956 A G 4: 127,951,036 S305P probably benign Het
Clip2 T C 5: 134,503,115 D612G probably damaging Het
Col28a1 T C 6: 8,059,360 T692A probably benign Het
Copg2 A T 6: 30,816,741 probably null Het
Ctnna2 T A 6: 76,973,791 I566F possibly damaging Het
Cux2 C T 5: 121,861,326 D1184N probably benign Het
Dclk3 A G 9: 111,468,354 E322G probably benign Het
Ddx41 A T 13: 55,534,093 probably null Het
Dnaaf2 G A 12: 69,196,785 P107S probably damaging Het
Eif2ak4 A G 2: 118,430,947 E578G probably damaging Het
Exd1 A G 2: 119,528,663 probably benign Het
Fat2 G A 11: 55,282,757 P2377S probably damaging Het
Fbxl18 T C 5: 142,872,459 T741A probably benign Het
Fgr C A 4: 132,997,521 A311E probably damaging Het
Fmo4 T C 1: 162,798,889 T363A probably damaging Het
Fsbp T C 4: 11,584,006 V235A probably benign Het
Gm1110 T A 9: 26,894,258 H366L probably benign Het
Gm43302 T C 5: 105,290,980 N14S probably damaging Het
Gm5422 A G 10: 31,248,768 noncoding transcript Het
Gpr21 A G 2: 37,517,535 E31G probably damaging Het
Gucy1b2 G T 14: 62,408,758 N560K probably damaging Het
Hmcn1 T C 1: 150,677,334 Q2535R probably benign Het
Hnrnpm A T 17: 33,664,624 N264K probably damaging Het
Hyal6 A T 6: 24,734,724 I219L possibly damaging Het
Ifi211 A G 1: 173,907,603 S87P probably damaging Het
Il17rb A T 14: 29,996,840 C428* probably null Het
Iqca T C 1: 90,045,626 N808S probably benign Het
Kcnu1 A G 8: 25,918,442 I94V probably benign Het
Lrba A T 3: 86,310,017 E517V probably damaging Het
Mcidas A G 13: 112,993,981 E37G possibly damaging Het
Med23 T A 10: 24,879,755 F83L possibly damaging Het
Micu2 T C 14: 57,954,133 probably null Het
Mrgprx2 A T 7: 48,482,534 C179S probably damaging Het
Myo6 A G 9: 80,307,722 T1236A probably damaging Het
Myo7a A T 7: 98,054,708 V1946E possibly damaging Het
Nek10 A T 14: 14,885,122 Y695F probably damaging Het
Nr3c2 A T 8: 76,909,793 I508F possibly damaging Het
Olfr1056 A T 2: 86,356,186 H65Q possibly damaging Het
Olfr1133 A T 2: 87,645,889 I78N probably damaging Het
Olfr12 T C 1: 92,620,749 V281A probably benign Het
Olfr307 A T 7: 86,335,747 Y216* probably null Het
Olfr695 T C 7: 106,873,427 I273V probably benign Het
Olfr743 T C 14: 50,533,684 S91P probably damaging Het
Oxct1 T C 15: 4,153,761 S485P probably benign Het
Oxt A G 2: 130,576,652 D61G probably damaging Het
P2ry10 A C X: 107,102,635 I59L probably damaging Het
Parp11 A G 6: 127,477,891 N124S probably benign Het
Pcdh7 T A 5: 57,719,629 N175K probably damaging Het
Pdgfrb T A 18: 61,061,494 S114R probably benign Het
Pfdn5 A G 15: 102,326,521 N54S possibly damaging Het
Phc2 T A 4: 128,723,585 V468E probably benign Het
Piezo2 T C 18: 63,059,744 T1605A probably damaging Het
Pik3cb A T 9: 99,105,579 Y35* probably null Het
Piwil2 A T 14: 70,426,634 M22K probably damaging Het
Plag1 A G 4: 3,904,889 F101L probably damaging Het
Pomt2 A G 12: 87,111,399 L680P possibly damaging Het
Ppp1r36 A G 12: 76,418,926 probably null Het
Prkag2 C T 5: 24,871,054 probably null Het
Prkg1 T C 19: 31,664,142 D47G possibly damaging Het
Prl6a1 G A 13: 27,315,369 G45D probably benign Het
Rbm20 G A 19: 53,859,428 C1135Y probably damaging Het
Recql5 A T 11: 115,897,097 N465K probably benign Het
Rtcb A T 10: 85,941,933 I459N probably damaging Het
Rtp3 A T 9: 110,986,034 probably benign Het
Rundc3b T A 5: 8,512,409 probably null Het
Scube3 A G 17: 28,168,158 T877A probably damaging Het
Sh2d4a A T 8: 68,346,742 Q421L probably benign Het
Siglec1 A T 2: 131,083,357 Y395N probably damaging Het
Slc6a1 G T 6: 114,307,770 G263V probably damaging Het
Slco1c1 T A 6: 141,555,107 F437L probably benign Het
Slco3a1 G A 7: 74,346,671 A329V probably benign Het
Spag9 T A 11: 94,092,375 L504* probably null Het
Spen A T 4: 141,473,329 N2662K probably damaging Het
Sptb G C 12: 76,632,472 R70G possibly damaging Het
Stk3 A G 15: 35,072,498 S136P probably damaging Het
Synj1 A T 16: 90,938,696 F1456L probably damaging Het
Tchh G A 3: 93,446,961 R1236Q unknown Het
Timd4 C A 11: 46,820,030 T253K possibly damaging Het
Tmc6 A G 11: 117,769,406 Y669H probably damaging Het
Tmem151a C T 19: 5,082,938 R80H probably benign Het
Tpgs1 T C 10: 79,675,888 L288P probably damaging Het
Trhde T C 10: 114,498,793 I659V probably benign Het
Trpm7 A T 2: 126,823,997 Y896* probably null Het
Ttc5 C A 14: 50,781,550 E37* probably null Het
Uvrag A G 7: 98,939,889 probably null Het
Vmn1r59 T A 7: 5,454,284 D159V probably damaging Het
Vmn2r78 G A 7: 86,955,079 V822M possibly damaging Het
Vnn1 C A 10: 23,894,971 Y32* probably null Het
Wrn A G 8: 33,236,404 V1380A probably benign Het
Zc3h14 A C 12: 98,780,268 S579R possibly damaging Het
Zfp277 G A 12: 40,317,218 Q480* probably null Het
Zfp456 G A 13: 67,366,874 Q238* probably null Het
Zranb3 T A 1: 128,091,901 T35S probably benign Het
Other mutations in Tbx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Tbx5 APN 5 119883026 missense probably benign
IGL01595:Tbx5 APN 5 119840838 missense probably damaging 1.00
IGL01758:Tbx5 APN 5 119844958 unclassified probably benign
IGL02239:Tbx5 APN 5 119871280 missense possibly damaging 0.68
IGL02625:Tbx5 APN 5 119836907 utr 5 prime probably benign
IGL03326:Tbx5 APN 5 119871298 missense probably damaging 0.99
R0477:Tbx5 UTSW 5 119883119 missense possibly damaging 0.89
R0485:Tbx5 UTSW 5 119883458 missense probably benign 0.00
R1218:Tbx5 UTSW 5 119838720 missense probably damaging 1.00
R1756:Tbx5 UTSW 5 119845113 unclassified probably null
R2125:Tbx5 UTSW 5 119836923 missense probably benign
R2126:Tbx5 UTSW 5 119836923 missense probably benign
R2268:Tbx5 UTSW 5 119845109 splice site probably null
R2302:Tbx5 UTSW 5 119841859 missense probably damaging 1.00
R4693:Tbx5 UTSW 5 119841899 missense probably damaging 1.00
R4930:Tbx5 UTSW 5 119883025 missense probably benign 0.44
R5062:Tbx5 UTSW 5 119836922 missense probably damaging 0.99
R5245:Tbx5 UTSW 5 119883165 missense possibly damaging 0.95
R6067:Tbx5 UTSW 5 119883146 missense probably benign
R6079:Tbx5 UTSW 5 119883146 missense probably benign
R6138:Tbx5 UTSW 5 119883146 missense probably benign
R6218:Tbx5 UTSW 5 119853598 missense probably damaging 1.00
R6528:Tbx5 UTSW 5 119883111 missense probably damaging 0.97
R6700:Tbx5 UTSW 5 119871397 missense probably benign 0.30
R6993:Tbx5 UTSW 5 119871389 missense possibly damaging 0.75
R7777:Tbx5 UTSW 5 119883167 missense probably benign 0.00
R7801:Tbx5 UTSW 5 119836999 missense probably benign 0.44
R8056:Tbx5 UTSW 5 119853613 missense probably benign
U15987:Tbx5 UTSW 5 119883146 missense probably benign
X0028:Tbx5 UTSW 5 119845119 critical splice donor site probably null
Z1176:Tbx5 UTSW 5 119883315 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGCAGCTCTCTTCTGACCAG -3'
(R):5'- CTGACAACTTCAGCCTTGAGG -3'

Sequencing Primer
(F):5'- TCTGACCAGCTACCTCCAGG -3'
(R):5'- GGTGGGTCCCAATTAGCTG -3'
Posted On2014-08-25