Incidental Mutation 'R0136:Zzef1'
ID21967
Institutional Source Beutler Lab
Gene Symbol Zzef1
Ensembl Gene ENSMUSG00000055670
Gene Namezinc finger, ZZ-type with EF hand domain 1
SynonymsC130099L13Rik, 8430405D05Rik
MMRRC Submission 038421-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0136 (G1)
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location72796226-72927120 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72821851 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 199 (V199A)
Ref Sequence ENSEMBL: ENSMUSP00000147028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069395] [ENSMUST00000172220] [ENSMUST00000207107]
Predicted Effect probably benign
Transcript: ENSMUST00000069395
AA Change: V199A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000068790
Gene: ENSMUSG00000055670
AA Change: V199A

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 28 68 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
APC10 246 397 2.65e-48 SMART
internal_repeat_1 1122 1192 1.25e-7 PROSPERO
low complexity region 1472 1485 N/A INTRINSIC
low complexity region 1512 1525 N/A INTRINSIC
ZnF_ZZ 1775 1823 2.54e-7 SMART
ZnF_ZZ 1824 1868 1.2e-8 SMART
low complexity region 1947 1963 N/A INTRINSIC
low complexity region 2127 2140 N/A INTRINSIC
low complexity region 2249 2263 N/A INTRINSIC
internal_repeat_1 2657 2726 1.25e-7 PROSPERO
low complexity region 2840 2853 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150551
Predicted Effect probably benign
Transcript: ENSMUST00000172220
AA Change: V199A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130515
Gene: ENSMUSG00000055670
AA Change: V199A

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 28 68 N/A INTRINSIC
low complexity region 78 93 N/A INTRINSIC
APC10 246 397 2.65e-48 SMART
internal_repeat_1 1006 1192 1.57e-16 PROSPERO
low complexity region 1472 1485 N/A INTRINSIC
low complexity region 1512 1525 N/A INTRINSIC
ZnF_ZZ 1775 1823 2.54e-7 SMART
ZnF_ZZ 1824 1868 1.2e-8 SMART
low complexity region 1947 1963 N/A INTRINSIC
low complexity region 2127 2140 N/A INTRINSIC
low complexity region 2249 2263 N/A INTRINSIC
internal_repeat_1 2583 2759 1.57e-16 PROSPERO
low complexity region 2873 2886 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207107
AA Change: V199A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.0761 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 89% (56/63)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap4b1 T C 3: 103,809,946 M1T probably null Het
Arg2 T C 12: 79,150,006 L167P probably damaging Het
Atxn1 A G 13: 45,567,169 S417P probably damaging Het
Baz2b A G 2: 59,901,954 V1949A probably benign Het
Bcl3 A G 7: 19,809,569 V324A probably damaging Het
Btbd10 A T 7: 113,329,878 S230T possibly damaging Het
Camta1 A G 4: 151,078,969 S1479P probably damaging Het
Cd69 C T 6: 129,270,062 S64N probably benign Het
Col5a1 T C 2: 28,024,831 L153P probably damaging Het
Crat C A 2: 30,407,030 V304L probably benign Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Fau T C 19: 6,059,180 V86A possibly damaging Het
Garem1 T G 18: 21,129,991 S589R probably damaging Het
Gbp3 T G 3: 142,564,101 probably null Het
Gin1 T A 1: 97,783,016 S141R possibly damaging Het
Gtf2h1 A T 7: 46,815,416 Q419L possibly damaging Het
Hipk3 A G 2: 104,439,293 I517T probably benign Het
Hivep2 T C 10: 14,131,878 S1407P probably benign Het
Hnrnpk G T 13: 58,395,177 D211E probably benign Het
Hnrnpul2 T C 19: 8,826,801 L588P probably damaging Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Itgb1 T G 8: 128,722,854 Y585D possibly damaging Het
Kmt2d C T 15: 98,854,278 probably benign Het
Map7d1 A T 4: 126,236,631 probably null Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Med13l A G 5: 118,724,050 T353A probably benign Het
Mgat4b T C 11: 50,231,081 V143A possibly damaging Het
Mlxip T A 5: 123,442,306 W211R probably damaging Het
Morc2a T G 11: 3,685,907 probably null Het
Muc4 A T 16: 32,750,195 probably benign Het
Ndufa10 A T 1: 92,463,128 Y233* probably null Het
Nek8 C T 11: 78,171,207 S237N probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nfatc2ip A G 7: 126,391,335 S165P probably benign Het
Nsd2 A G 5: 33,855,536 K404E possibly damaging Het
Nsd3 G T 8: 25,659,854 E352* probably null Het
Nudt9 A G 5: 104,047,106 T23A probably benign Het
Olfr394 T C 11: 73,887,785 M196V probably benign Het
Olfr394 C T 11: 73,887,830 V181I probably benign Het
Olfr983 A G 9: 40,092,019 *312Q probably null Het
Patj C A 4: 98,667,648 Q297K probably damaging Het
Pelo A T 13: 115,088,903 C40* probably null Het
Pnpla3 G A 15: 84,174,478 probably null Het
Pramel1 C A 4: 143,397,446 N230K probably damaging Het
Psg20 A C 7: 18,682,507 L228R probably damaging Het
Rsph10b T C 5: 143,959,821 F44L probably benign Het
Sept2 G A 1: 93,507,050 G358R possibly damaging Het
Slamf7 G A 1: 171,648,931 probably benign Het
Slc12a8 A G 16: 33,608,213 D297G probably damaging Het
Slc17a5 G A 9: 78,578,674 A43V probably damaging Het
Slc22a1 A T 17: 12,662,596 F335L probably benign Het
Slc26a5 T C 5: 21,834,347 N216S probably damaging Het
Snrnp27 T C 6: 86,676,205 S144G probably benign Het
Spata20 T A 11: 94,480,609 D643V probably damaging Het
Spata24 T C 18: 35,660,462 K99R probably damaging Het
Taar5 A G 10: 23,971,709 Y335C probably damaging Het
Tpr A G 1: 150,430,595 H1540R probably benign Het
Vmn1r27 A G 6: 58,215,719 F100S possibly damaging Het
Vmn2r37 A T 7: 9,217,783 Y360* probably null Het
Ybx1 C A 4: 119,282,354 R36L possibly damaging Het
Zfp369 A G 13: 65,297,202 K720E probably benign Het
Zfp599 A G 9: 22,249,742 S376P probably benign Het
Zic2 A G 14: 122,476,541 E289G probably damaging Het
Other mutations in Zzef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Zzef1 APN 11 72875126 missense probably benign 0.02
IGL00898:Zzef1 APN 11 72875173 missense probably benign 0.00
IGL00970:Zzef1 APN 11 72915245 missense probably benign 0.06
IGL01062:Zzef1 APN 11 72874969 missense probably benign
IGL01832:Zzef1 APN 11 72875066 missense probably damaging 0.99
IGL02005:Zzef1 APN 11 72888299 missense probably benign 0.00
IGL02026:Zzef1 APN 11 72881338 missense probably benign 0.39
IGL02110:Zzef1 APN 11 72913112 missense probably damaging 1.00
IGL02305:Zzef1 APN 11 72866597 splice site probably benign
IGL02308:Zzef1 APN 11 72886747 missense probably benign 0.04
IGL02315:Zzef1 APN 11 72875257 nonsense probably null
IGL02332:Zzef1 APN 11 72916509 missense probably benign 0.01
IGL02389:Zzef1 APN 11 72891217 missense probably benign
IGL02389:Zzef1 APN 11 72899538 missense possibly damaging 0.89
IGL02451:Zzef1 APN 11 72901388 missense probably damaging 0.99
IGL02541:Zzef1 APN 11 72872649 missense probably damaging 1.00
IGL02950:Zzef1 APN 11 72917699 splice site probably benign
IGL02953:Zzef1 APN 11 72855398 missense probably benign
IGL03053:Zzef1 APN 11 72831539 splice site probably benign
IGL03085:Zzef1 APN 11 72855524 splice site probably benign
IGL03152:Zzef1 APN 11 72923182 critical splice donor site probably null
IGL03329:Zzef1 APN 11 72917273 splice site probably benign
IGL03376:Zzef1 APN 11 72876551 splice site probably benign
IGL03394:Zzef1 APN 11 72886775 splice site probably null
Dreidel UTSW 11 72908469 nonsense probably null
Hanukkah UTSW 11 72893332 missense probably benign 0.00
Mezuzah UTSW 11 72848733 nonsense probably null
BB005:Zzef1 UTSW 11 72821896 missense probably damaging 0.99
BB015:Zzef1 UTSW 11 72821896 missense probably damaging 0.99
PIT4508001:Zzef1 UTSW 11 72895176 missense probably benign
PIT4581001:Zzef1 UTSW 11 72899672 missense probably benign 0.00
PIT4810001:Zzef1 UTSW 11 72850745 missense probably damaging 1.00
R0094:Zzef1 UTSW 11 72817965 missense probably benign 0.01
R0119:Zzef1 UTSW 11 72821851 missense probably benign
R0140:Zzef1 UTSW 11 72899551 missense possibly damaging 0.70
R0212:Zzef1 UTSW 11 72873910 missense possibly damaging 0.66
R0217:Zzef1 UTSW 11 72889068 missense probably damaging 1.00
R0220:Zzef1 UTSW 11 72865966 missense probably damaging 1.00
R0304:Zzef1 UTSW 11 72880624 missense probably benign 0.10
R0400:Zzef1 UTSW 11 72895242 missense probably damaging 1.00
R0422:Zzef1 UTSW 11 72866091 missense possibly damaging 0.93
R0471:Zzef1 UTSW 11 72923111 missense probably damaging 1.00
R0557:Zzef1 UTSW 11 72917730 missense probably damaging 1.00
R0581:Zzef1 UTSW 11 72851900 missense probably benign 0.00
R0599:Zzef1 UTSW 11 72913178 missense probably damaging 1.00
R0603:Zzef1 UTSW 11 72818069 missense probably benign 0.00
R0657:Zzef1 UTSW 11 72821851 missense probably benign
R0987:Zzef1 UTSW 11 72901333 small deletion probably benign
R1246:Zzef1 UTSW 11 72874909 missense probably benign 0.00
R1327:Zzef1 UTSW 11 72893414 critical splice donor site probably null
R1438:Zzef1 UTSW 11 72912945 missense probably damaging 0.96
R1466:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1466:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1485:Zzef1 UTSW 11 72900809 splice site probably null
R1556:Zzef1 UTSW 11 72915233 missense probably damaging 1.00
R1563:Zzef1 UTSW 11 72848733 nonsense probably null
R1584:Zzef1 UTSW 11 72924679 missense probably damaging 1.00
R1643:Zzef1 UTSW 11 72826202 missense probably damaging 1.00
R1646:Zzef1 UTSW 11 72864036 critical splice donor site probably null
R1764:Zzef1 UTSW 11 72893332 missense probably benign 0.00
R1777:Zzef1 UTSW 11 72910272 missense probably damaging 1.00
R1793:Zzef1 UTSW 11 72886709 missense probably damaging 1.00
R1900:Zzef1 UTSW 11 72848714 missense probably damaging 0.99
R2096:Zzef1 UTSW 11 72872639 missense probably benign 0.02
R2134:Zzef1 UTSW 11 72880624 missense probably benign 0.02
R2157:Zzef1 UTSW 11 72848634 splice site probably benign
R2183:Zzef1 UTSW 11 72886718 nonsense probably null
R2192:Zzef1 UTSW 11 72910156 splice site probably null
R2230:Zzef1 UTSW 11 72884416 missense probably damaging 0.99
R2259:Zzef1 UTSW 11 72900633 nonsense probably null
R2384:Zzef1 UTSW 11 72858394 missense probably damaging 0.99
R2426:Zzef1 UTSW 11 72915265 missense probably benign 0.01
R2915:Zzef1 UTSW 11 72910326 splice site probably null
R3700:Zzef1 UTSW 11 72886772 missense probably null 1.00
R3875:Zzef1 UTSW 11 72889040 missense probably benign 0.22
R3902:Zzef1 UTSW 11 72908500 missense probably damaging 1.00
R3927:Zzef1 UTSW 11 72858382 missense probably damaging 1.00
R4086:Zzef1 UTSW 11 72875053 missense probably benign 0.02
R4301:Zzef1 UTSW 11 72889035 missense probably damaging 0.96
R4359:Zzef1 UTSW 11 72823508 missense probably damaging 0.98
R4382:Zzef1 UTSW 11 72875112 missense probably benign 0.00
R4453:Zzef1 UTSW 11 72872639 missense probably benign 0.02
R4466:Zzef1 UTSW 11 72924659 missense probably damaging 1.00
R4471:Zzef1 UTSW 11 72913331 missense probably damaging 1.00
R4510:Zzef1 UTSW 11 72888170 missense probably benign 0.32
R4511:Zzef1 UTSW 11 72888170 missense probably benign 0.32
R4714:Zzef1 UTSW 11 72837212 missense probably damaging 1.00
R4799:Zzef1 UTSW 11 72859623 missense probably benign 0.12
R4906:Zzef1 UTSW 11 72901388 missense probably damaging 1.00
R5075:Zzef1 UTSW 11 72858344 missense probably damaging 1.00
R5357:Zzef1 UTSW 11 72843333 nonsense probably null
R5579:Zzef1 UTSW 11 72900637 missense probably damaging 0.98
R5598:Zzef1 UTSW 11 72916521 missense probably damaging 1.00
R5725:Zzef1 UTSW 11 72855482 missense possibly damaging 0.86
R5765:Zzef1 UTSW 11 72821937 nonsense probably null
R5928:Zzef1 UTSW 11 72912852 missense probably damaging 1.00
R6003:Zzef1 UTSW 11 72824065 splice site probably null
R6047:Zzef1 UTSW 11 72866095 missense probably damaging 0.99
R6224:Zzef1 UTSW 11 72855383 missense probably damaging 0.99
R6225:Zzef1 UTSW 11 72869805 missense possibly damaging 0.62
R6287:Zzef1 UTSW 11 72923112 missense probably damaging 1.00
R6361:Zzef1 UTSW 11 72884349 missense possibly damaging 0.93
R6451:Zzef1 UTSW 11 72923156 missense possibly damaging 0.88
R6467:Zzef1 UTSW 11 72911264 critical splice donor site probably null
R6484:Zzef1 UTSW 11 72895271 missense probably damaging 1.00
R6493:Zzef1 UTSW 11 72913303 missense probably benign 0.06
R6520:Zzef1 UTSW 11 72826065 missense probably damaging 1.00
R6527:Zzef1 UTSW 11 72874990 missense probably benign 0.00
R6540:Zzef1 UTSW 11 72913229 missense probably damaging 1.00
R6608:Zzef1 UTSW 11 72912826 missense probably damaging 1.00
R6795:Zzef1 UTSW 11 72850659 missense probably benign 0.00
R6927:Zzef1 UTSW 11 72913157 missense probably damaging 1.00
R6987:Zzef1 UTSW 11 72855514 missense possibly damaging 0.89
R7048:Zzef1 UTSW 11 72866699 nonsense probably null
R7076:Zzef1 UTSW 11 72899559 missense probably benign 0.00
R7099:Zzef1 UTSW 11 72872649 missense possibly damaging 0.92
R7132:Zzef1 UTSW 11 72917871 critical splice donor site probably null
R7175:Zzef1 UTSW 11 72851901 missense possibly damaging 0.49
R7284:Zzef1 UTSW 11 72886690 missense probably damaging 0.99
R7300:Zzef1 UTSW 11 72875004 missense probably benign 0.02
R7486:Zzef1 UTSW 11 72864786 missense possibly damaging 0.85
R7503:Zzef1 UTSW 11 72826067 missense probably damaging 1.00
R7679:Zzef1 UTSW 11 72893278 missense probably benign
R7874:Zzef1 UTSW 11 72859653 missense probably benign 0.01
R7898:Zzef1 UTSW 11 72796547 missense probably damaging 1.00
R7928:Zzef1 UTSW 11 72821896 missense probably damaging 0.99
R8021:Zzef1 UTSW 11 72823416 missense probably damaging 0.99
R8145:Zzef1 UTSW 11 72908469 nonsense probably null
R8255:Zzef1 UTSW 11 72875129 missense probably benign 0.00
R8303:Zzef1 UTSW 11 72917189 missense probably damaging 1.00
R8492:Zzef1 UTSW 11 72872604 missense probably damaging 1.00
R8492:Zzef1 UTSW 11 72886746 missense probably damaging 0.97
R8498:Zzef1 UTSW 11 72853322 missense probably damaging 1.00
R8547:Zzef1 UTSW 11 72844441 missense probably damaging 1.00
X0028:Zzef1 UTSW 11 72906979 missense probably benign 0.29
Z1176:Zzef1 UTSW 11 72796528 missense probably damaging 1.00
Z1177:Zzef1 UTSW 11 72796312 missense possibly damaging 0.91
Z1177:Zzef1 UTSW 11 72826178 missense probably damaging 1.00
Z1177:Zzef1 UTSW 11 72900631 critical splice acceptor site probably null
Z1177:Zzef1 UTSW 11 72915320 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTTCAGATGGGGCAGCAGATAC -3'
(R):5'- TGGGGACCAAACGCAAGTCATCAG -3'

Sequencing Primer
(F):5'- ACAGGATGTGGGAACTATTGTG -3'
(R):5'- CAGGCTGAACATTCTTAGGCTAC -3'
Posted On2013-04-12