Mutagenetix > Incidental Mutations

Incidental Mutation 'R0136:Zzef1'

21967

Institutional Source

Beutler Lab

Gene Symbol

Zzef1

Ensembl Gene

ENSMUSG00000055670

Gene Name

zinc finger, ZZ-type with EF hand domain 1

Synonyms

C130099L13Rik, 8430405D05Rik

MMRRC Submission

038421-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0136 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

72796226-72927120 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 72821851 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 199 (V199A)

Ref Sequence

ENSEMBL: ENSMUSP00000147028 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069395] [ENSMUST00000172220] [ENSMUST00000207107]

Predicted Effect

probably benign
Transcript: ENSMUST00000069395
AA Change: V199A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000068790
Gene: ENSMUSG00000055670
AA Change: V199A

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
low complexity region	28	68	N/A	INTRINSIC
low complexity region	78	93	N/A	INTRINSIC
APC10	246	397	2.65e-48	SMART
internal_repeat_1	1122	1192	1.25e-7	PROSPERO
low complexity region	1472	1485	N/A	INTRINSIC
low complexity region	1512	1525	N/A	INTRINSIC
ZnF_ZZ	1775	1823	2.54e-7	SMART
ZnF_ZZ	1824	1868	1.2e-8	SMART
low complexity region	1947	1963	N/A	INTRINSIC
low complexity region	2127	2140	N/A	INTRINSIC
low complexity region	2249	2263	N/A	INTRINSIC
internal_repeat_1	2657	2726	1.25e-7	PROSPERO
low complexity region	2840	2853	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150551

Predicted Effect

probably benign
Transcript: ENSMUST00000172220
AA Change: V199A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000130515
Gene: ENSMUSG00000055670
AA Change: V199A

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
low complexity region	28	68	N/A	INTRINSIC
low complexity region	78	93	N/A	INTRINSIC
APC10	246	397	2.65e-48	SMART
internal_repeat_1	1006	1192	1.57e-16	PROSPERO
low complexity region	1472	1485	N/A	INTRINSIC
low complexity region	1512	1525	N/A	INTRINSIC
ZnF_ZZ	1775	1823	2.54e-7	SMART
ZnF_ZZ	1824	1868	1.2e-8	SMART
low complexity region	1947	1963	N/A	INTRINSIC
low complexity region	2127	2140	N/A	INTRINSIC
low complexity region	2249	2263	N/A	INTRINSIC
internal_repeat_1	2583	2759	1.57e-16	PROSPERO
low complexity region	2873	2886	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000207107
AA Change: V199A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.0761

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.5%
20x: 93.3%

Validation Efficiency

89% (56/63)

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ap4b1	T	C	3: 103,809,946	M1T	probably null	Het
Arg2	T	C	12: 79,150,006	L167P	probably damaging	Het
Atxn1	A	G	13: 45,567,169	S417P	probably damaging	Het
Baz2b	A	G	2: 59,901,954	V1949A	probably benign	Het
Bcl3	A	G	7: 19,809,569	V324A	probably damaging	Het
Btbd10	A	T	7: 113,329,878	S230T	possibly damaging	Het
Camta1	A	G	4: 151,078,969	S1479P	probably damaging	Het
Cd69	C	T	6: 129,270,062	S64N	probably benign	Het
Col5a1	T	C	2: 28,024,831	L153P	probably damaging	Het
Crat	C	A	2: 30,407,030	V304L	probably benign	Het
Csmd3	T	C	15: 47,847,131	T1687A	probably benign	Het
Dnah1	C	T	14: 31,276,158	G2574D	probably damaging	Het
Fau	T	C	19: 6,059,180	V86A	possibly damaging	Het
Garem1	T	G	18: 21,129,991	S589R	probably damaging	Het
Gbp3	T	G	3: 142,564,101		probably null	Het
Gin1	T	A	1: 97,783,016	S141R	possibly damaging	Het
Gtf2h1	A	T	7: 46,815,416	Q419L	possibly damaging	Het
Hipk3	A	G	2: 104,439,293	I517T	probably benign	Het
Hivep2	T	C	10: 14,131,878	S1407P	probably benign	Het
Hnrnpk	G	T	13: 58,395,177	D211E	probably benign	Het
Hnrnpul2	T	C	19: 8,826,801	L588P	probably damaging	Het
Il18rap	A	T	1: 40,525,058	H112L	probably benign	Het
Itgb1	T	G	8: 128,722,854	Y585D	possibly damaging	Het
Kmt2d	C	T	15: 98,854,278		probably benign	Het
Map7d1	A	T	4: 126,236,631		probably null	Het
Me2	A	G	18: 73,770,673	S575P	probably benign	Het
Med13l	A	G	5: 118,724,050	T353A	probably benign	Het
Mgat4b	T	C	11: 50,231,081	V143A	possibly damaging	Het
Mlxip	T	A	5: 123,442,306	W211R	probably damaging	Het
Morc2a	T	G	11: 3,685,907		probably null	Het
Muc4	A	T	16: 32,750,195		probably benign	Het
Ndufa10	A	T	1: 92,463,128	Y233*	probably null	Het
Nek8	C	T	11: 78,171,207	S237N	probably benign	Het
Neto1	G	A	18: 86,461,320	R211Q	probably benign	Het
Nfatc2ip	A	G	7: 126,391,335	S165P	probably benign	Het
Nsd2	A	G	5: 33,855,536	K404E	possibly damaging	Het
Nsd3	G	T	8: 25,659,854	E352*	probably null	Het
Nudt9	A	G	5: 104,047,106	T23A	probably benign	Het
Olfr394	T	C	11: 73,887,785	M196V	probably benign	Het
Olfr394	C	T	11: 73,887,830	V181I	probably benign	Het
Olfr983	A	G	9: 40,092,019	*312Q	probably null	Het
Patj	C	A	4: 98,667,648	Q297K	probably damaging	Het
Pelo	A	T	13: 115,088,903	C40*	probably null	Het
Pnpla3	G	A	15: 84,174,478		probably null	Het
Pramel1	C	A	4: 143,397,446	N230K	probably damaging	Het
Psg20	A	C	7: 18,682,507	L228R	probably damaging	Het
Rsph10b	T	C	5: 143,959,821	F44L	probably benign	Het
Sept2	G	A	1: 93,507,050	G358R	possibly damaging	Het
Slamf7	G	A	1: 171,648,931		probably benign	Het
Slc12a8	A	G	16: 33,608,213	D297G	probably damaging	Het
Slc17a5	G	A	9: 78,578,674	A43V	probably damaging	Het
Slc22a1	A	T	17: 12,662,596	F335L	probably benign	Het
Slc26a5	T	C	5: 21,834,347	N216S	probably damaging	Het
Snrnp27	T	C	6: 86,676,205	S144G	probably benign	Het
Spata20	T	A	11: 94,480,609	D643V	probably damaging	Het
Spata24	T	C	18: 35,660,462	K99R	probably damaging	Het
Taar5	A	G	10: 23,971,709	Y335C	probably damaging	Het
Tpr	A	G	1: 150,430,595	H1540R	probably benign	Het
Vmn1r27	A	G	6: 58,215,719	F100S	possibly damaging	Het
Vmn2r37	A	T	7: 9,217,783	Y360*	probably null	Het
Ybx1	C	A	4: 119,282,354	R36L	possibly damaging	Het
Zfp369	A	G	13: 65,297,202	K720E	probably benign	Het
Zfp599	A	G	9: 22,249,742	S376P	probably benign	Het
Zic2	A	G	14: 122,476,541	E289G	probably damaging	Het

Other mutations in Zzef1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Zzef1	APN	11	72875126	missense	probably benign	0.02
IGL00898:Zzef1	APN	11	72875173	missense	probably benign	0.00
IGL00970:Zzef1	APN	11	72915245	missense	probably benign	0.06
IGL01062:Zzef1	APN	11	72874969	missense	probably benign
IGL01832:Zzef1	APN	11	72875066	missense	probably damaging	0.99
IGL02005:Zzef1	APN	11	72888299	missense	probably benign	0.00
IGL02026:Zzef1	APN	11	72881338	missense	probably benign	0.39
IGL02110:Zzef1	APN	11	72913112	missense	probably damaging	1.00
IGL02305:Zzef1	APN	11	72866597	splice site	probably benign
IGL02308:Zzef1	APN	11	72886747	missense	probably benign	0.04
IGL02315:Zzef1	APN	11	72875257	nonsense	probably null
IGL02332:Zzef1	APN	11	72916509	missense	probably benign	0.01
IGL02389:Zzef1	APN	11	72891217	missense	probably benign
IGL02389:Zzef1	APN	11	72899538	missense	possibly damaging	0.89
IGL02451:Zzef1	APN	11	72901388	missense	probably damaging	0.99
IGL02541:Zzef1	APN	11	72872649	missense	probably damaging	1.00
IGL02950:Zzef1	APN	11	72917699	splice site	probably benign
IGL02953:Zzef1	APN	11	72855398	missense	probably benign
IGL03053:Zzef1	APN	11	72831539	splice site	probably benign
IGL03085:Zzef1	APN	11	72855524	splice site	probably benign
IGL03152:Zzef1	APN	11	72923182	critical splice donor site	probably null
IGL03329:Zzef1	APN	11	72917273	splice site	probably benign
IGL03376:Zzef1	APN	11	72876551	splice site	probably benign
IGL03394:Zzef1	APN	11	72886775	splice site	probably null
Dreidel	UTSW	11	72908469	nonsense	probably null
Hanukkah	UTSW	11	72893332	missense	probably benign	0.00
Mezuzah	UTSW	11	72848733	nonsense	probably null
BB005:Zzef1	UTSW	11	72821896	missense	probably damaging	0.99
BB015:Zzef1	UTSW	11	72821896	missense	probably damaging	0.99
PIT4508001:Zzef1	UTSW	11	72895176	missense	probably benign
PIT4581001:Zzef1	UTSW	11	72899672	missense	probably benign	0.00
PIT4810001:Zzef1	UTSW	11	72850745	missense	probably damaging	1.00
R0094:Zzef1	UTSW	11	72817965	missense	probably benign	0.01
R0119:Zzef1	UTSW	11	72821851	missense	probably benign
R0140:Zzef1	UTSW	11	72899551	missense	possibly damaging	0.70
R0212:Zzef1	UTSW	11	72873910	missense	possibly damaging	0.66
R0217:Zzef1	UTSW	11	72889068	missense	probably damaging	1.00
R0220:Zzef1	UTSW	11	72865966	missense	probably damaging	1.00
R0304:Zzef1	UTSW	11	72880624	missense	probably benign	0.10
R0400:Zzef1	UTSW	11	72895242	missense	probably damaging	1.00
R0422:Zzef1	UTSW	11	72866091	missense	possibly damaging	0.93
R0471:Zzef1	UTSW	11	72923111	missense	probably damaging	1.00
R0557:Zzef1	UTSW	11	72917730	missense	probably damaging	1.00
R0581:Zzef1	UTSW	11	72851900	missense	probably benign	0.00
R0599:Zzef1	UTSW	11	72913178	missense	probably damaging	1.00
R0603:Zzef1	UTSW	11	72818069	missense	probably benign	0.00
R0657:Zzef1	UTSW	11	72821851	missense	probably benign
R0987:Zzef1	UTSW	11	72901333	small deletion	probably benign
R1246:Zzef1	UTSW	11	72874909	missense	probably benign	0.00
R1327:Zzef1	UTSW	11	72893414	critical splice donor site	probably null
R1438:Zzef1	UTSW	11	72912945	missense	probably damaging	0.96
R1466:Zzef1	UTSW	11	72924679	missense	probably damaging	1.00
R1466:Zzef1	UTSW	11	72924679	missense	probably damaging	1.00
R1485:Zzef1	UTSW	11	72900809	splice site	probably null
R1556:Zzef1	UTSW	11	72915233	missense	probably damaging	1.00
R1563:Zzef1	UTSW	11	72848733	nonsense	probably null
R1584:Zzef1	UTSW	11	72924679	missense	probably damaging	1.00
R1643:Zzef1	UTSW	11	72826202	missense	probably damaging	1.00
R1646:Zzef1	UTSW	11	72864036	critical splice donor site	probably null
R1764:Zzef1	UTSW	11	72893332	missense	probably benign	0.00
R1777:Zzef1	UTSW	11	72910272	missense	probably damaging	1.00
R1793:Zzef1	UTSW	11	72886709	missense	probably damaging	1.00
R1900:Zzef1	UTSW	11	72848714	missense	probably damaging	0.99
R2096:Zzef1	UTSW	11	72872639	missense	probably benign	0.02
R2134:Zzef1	UTSW	11	72880624	missense	probably benign	0.02
R2157:Zzef1	UTSW	11	72848634	splice site	probably benign
R2183:Zzef1	UTSW	11	72886718	nonsense	probably null
R2192:Zzef1	UTSW	11	72910156	splice site	probably null
R2230:Zzef1	UTSW	11	72884416	missense	probably damaging	0.99
R2259:Zzef1	UTSW	11	72900633	nonsense	probably null
R2384:Zzef1	UTSW	11	72858394	missense	probably damaging	0.99
R2426:Zzef1	UTSW	11	72915265	missense	probably benign	0.01
R2915:Zzef1	UTSW	11	72910326	splice site	probably null
R3700:Zzef1	UTSW	11	72886772	missense	probably null	1.00
R3875:Zzef1	UTSW	11	72889040	missense	probably benign	0.22
R3902:Zzef1	UTSW	11	72908500	missense	probably damaging	1.00
R3927:Zzef1	UTSW	11	72858382	missense	probably damaging	1.00
R4086:Zzef1	UTSW	11	72875053	missense	probably benign	0.02
R4301:Zzef1	UTSW	11	72889035	missense	probably damaging	0.96
R4359:Zzef1	UTSW	11	72823508	missense	probably damaging	0.98
R4382:Zzef1	UTSW	11	72875112	missense	probably benign	0.00
R4453:Zzef1	UTSW	11	72872639	missense	probably benign	0.02
R4466:Zzef1	UTSW	11	72924659	missense	probably damaging	1.00
R4471:Zzef1	UTSW	11	72913331	missense	probably damaging	1.00
R4510:Zzef1	UTSW	11	72888170	missense	probably benign	0.32
R4511:Zzef1	UTSW	11	72888170	missense	probably benign	0.32
R4714:Zzef1	UTSW	11	72837212	missense	probably damaging	1.00
R4799:Zzef1	UTSW	11	72859623	missense	probably benign	0.12
R4906:Zzef1	UTSW	11	72901388	missense	probably damaging	1.00
R5075:Zzef1	UTSW	11	72858344	missense	probably damaging	1.00
R5357:Zzef1	UTSW	11	72843333	nonsense	probably null
R5579:Zzef1	UTSW	11	72900637	missense	probably damaging	0.98
R5598:Zzef1	UTSW	11	72916521	missense	probably damaging	1.00
R5725:Zzef1	UTSW	11	72855482	missense	possibly damaging	0.86
R5765:Zzef1	UTSW	11	72821937	nonsense	probably null
R5928:Zzef1	UTSW	11	72912852	missense	probably damaging	1.00
R6003:Zzef1	UTSW	11	72824065	splice site	probably null
R6047:Zzef1	UTSW	11	72866095	missense	probably damaging	0.99
R6224:Zzef1	UTSW	11	72855383	missense	probably damaging	0.99
R6225:Zzef1	UTSW	11	72869805	missense	possibly damaging	0.62
R6287:Zzef1	UTSW	11	72923112	missense	probably damaging	1.00
R6361:Zzef1	UTSW	11	72884349	missense	possibly damaging	0.93
R6451:Zzef1	UTSW	11	72923156	missense	possibly damaging	0.88
R6467:Zzef1	UTSW	11	72911264	critical splice donor site	probably null
R6484:Zzef1	UTSW	11	72895271	missense	probably damaging	1.00
R6493:Zzef1	UTSW	11	72913303	missense	probably benign	0.06
R6520:Zzef1	UTSW	11	72826065	missense	probably damaging	1.00
R6527:Zzef1	UTSW	11	72874990	missense	probably benign	0.00
R6540:Zzef1	UTSW	11	72913229	missense	probably damaging	1.00
R6608:Zzef1	UTSW	11	72912826	missense	probably damaging	1.00
R6795:Zzef1	UTSW	11	72850659	missense	probably benign	0.00
R6927:Zzef1	UTSW	11	72913157	missense	probably damaging	1.00
R6987:Zzef1	UTSW	11	72855514	missense	possibly damaging	0.89
R7048:Zzef1	UTSW	11	72866699	nonsense	probably null
R7076:Zzef1	UTSW	11	72899559	missense	probably benign	0.00
R7099:Zzef1	UTSW	11	72872649	missense	possibly damaging	0.92
R7132:Zzef1	UTSW	11	72917871	critical splice donor site	probably null
R7175:Zzef1	UTSW	11	72851901	missense	possibly damaging	0.49
R7284:Zzef1	UTSW	11	72886690	missense	probably damaging	0.99
R7300:Zzef1	UTSW	11	72875004	missense	probably benign	0.02
R7486:Zzef1	UTSW	11	72864786	missense	possibly damaging	0.85
R7503:Zzef1	UTSW	11	72826067	missense	probably damaging	1.00
R7679:Zzef1	UTSW	11	72893278	missense	probably benign
R7874:Zzef1	UTSW	11	72859653	missense	probably benign	0.01
R7898:Zzef1	UTSW	11	72796547	missense	probably damaging	1.00
R7928:Zzef1	UTSW	11	72821896	missense	probably damaging	0.99
R8021:Zzef1	UTSW	11	72823416	missense	probably damaging	0.99
R8145:Zzef1	UTSW	11	72908469	nonsense	probably null
R8255:Zzef1	UTSW	11	72875129	missense	probably benign	0.00
R8303:Zzef1	UTSW	11	72917189	missense	probably damaging	1.00
R8492:Zzef1	UTSW	11	72872604	missense	probably damaging	1.00
R8492:Zzef1	UTSW	11	72886746	missense	probably damaging	0.97
R8498:Zzef1	UTSW	11	72853322	missense	probably damaging	1.00
R8547:Zzef1	UTSW	11	72844441	missense	probably damaging	1.00
X0028:Zzef1	UTSW	11	72906979	missense	probably benign	0.29
Z1176:Zzef1	UTSW	11	72796528	missense	probably damaging	1.00
Z1177:Zzef1	UTSW	11	72796312	missense	possibly damaging	0.91
Z1177:Zzef1	UTSW	11	72826178	missense	probably damaging	1.00
Z1177:Zzef1	UTSW	11	72900631	critical splice acceptor site	probably null
Z1177:Zzef1	UTSW	11	72915320	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGTTCAGATGGGGCAGCAGATAC -3'
(R):5'- TGGGGACCAAACGCAAGTCATCAG -3'

Sequencing Primer
(F):5'- ACAGGATGTGGGAACTATTGTG -3'
(R):5'- CAGGCTGAACATTCTTAGGCTAC -3'

Posted On

2013-04-12