Incidental Mutation 'R1970:Cdc7'
ID 219679
Institutional Source Beutler Lab
Gene Symbol Cdc7
Ensembl Gene ENSMUSG00000029283
Gene Name cell division cycle 7
Synonyms Cdc7l1, muCdc7, Cdc7
MMRRC Submission 039983-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1970 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 107112188-107132298 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 107120940 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031221] [ENSMUST00000076467] [ENSMUST00000117196] [ENSMUST00000118261] [ENSMUST00000129938]
AlphaFold Q9Z0H0
Predicted Effect probably benign
Transcript: ENSMUST00000031221
SMART Domains Protein: ENSMUSP00000031221
Gene: ENSMUSG00000029283

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 212 1.7e-14 PFAM
Pfam:Pkinase 52 216 4.4e-27 PFAM
Pfam:Pkinase 351 559 1.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076467
SMART Domains Protein: ENSMUSP00000075792
Gene: ENSMUSG00000029283

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 214 1.7e-14 PFAM
Pfam:Pkinase 52 227 1.1e-25 PFAM
Pfam:Pkinase 314 520 2.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117196
SMART Domains Protein: ENSMUSP00000112392
Gene: ENSMUSG00000029283

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 214 1e-14 PFAM
Pfam:Pkinase 52 227 6.6e-26 PFAM
Pfam:Pkinase 313 527 4.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118261
SMART Domains Protein: ENSMUSP00000113385
Gene: ENSMUSG00000029283

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 214 1.2e-14 PFAM
Pfam:Pkinase 52 227 7.4e-26 PFAM
Pfam:Pkinase 345 559 5.1e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123546
Predicted Effect probably benign
Transcript: ENSMUST00000129938
SMART Domains Protein: ENSMUSP00000119612
Gene: ENSMUSG00000029283

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 214 5.4e-15 PFAM
Pfam:Pkinase 52 227 3.4e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140378
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199223
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 97% (121/125)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell division cycle protein with kinase activity that is critical for the G1/S transition. The yeast homolog is also essential for initiation of DNA replication as cell division occurs. Overexpression of this gene product may be associated with neoplastic transformation for some tumors. Multiple alternatively spliced transcript variants that encode the same protein have been detected. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality between E3.5-E6.5. In conjunction with a Trp53-null allele, double homozygous mutant embryos survive up to E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 121 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,526,549 (GRCm39) H578Q probably benign Het
Abcc12 A G 8: 87,253,910 (GRCm39) I958T probably benign Het
Abcg5 AATCATTTG AG 17: 84,981,030 (GRCm39) probably null Het
Acap2 A G 16: 30,952,345 (GRCm39) probably null Het
Adgrb1 T C 15: 74,411,726 (GRCm39) probably benign Het
Akap6 T A 12: 52,985,258 (GRCm39) V897E probably damaging Het
Als2 A T 1: 59,254,328 (GRCm39) L343Q probably benign Het
Arhgap5 A G 12: 52,589,376 (GRCm39) I1275M probably damaging Het
Arnt C T 3: 95,355,704 (GRCm39) S16L possibly damaging Het
Bglap3 C T 3: 88,284,300 (GRCm39) probably benign Het
Blnk T C 19: 40,928,609 (GRCm39) probably benign Het
C1qtnf4 T C 2: 90,720,003 (GRCm39) M92T probably damaging Het
Ccdc177 G A 12: 80,805,486 (GRCm39) R263C unknown Het
Ccdc83 T A 7: 89,893,362 (GRCm39) S132C probably damaging Het
Cgnl1 T A 9: 71,632,817 (GRCm39) N178I probably benign Het
Col27a1 C T 4: 63,191,354 (GRCm39) probably benign Het
Col5a1 A T 2: 27,876,766 (GRCm39) M822L unknown Het
Coro7 T C 16: 4,451,620 (GRCm39) I451V probably benign Het
Csmd3 T C 15: 48,536,927 (GRCm39) T92A probably damaging Het
Ddc A G 11: 11,765,292 (GRCm39) V460A possibly damaging Het
Ddx4 C T 13: 112,736,547 (GRCm39) V608I probably damaging Het
Ddx60 A T 8: 62,425,240 (GRCm39) H676L possibly damaging Het
Dmtf1 T C 5: 9,198,989 (GRCm39) E48G probably benign Het
Dpf3 T A 12: 83,371,809 (GRCm39) probably null Het
Dydc2 A G 14: 40,783,860 (GRCm39) C88R probably benign Het
Elovl4 A G 9: 83,662,772 (GRCm39) Y163H probably damaging Het
Enpp2 T C 15: 54,746,378 (GRCm39) D296G probably damaging Het
Fam83h G T 15: 75,878,419 (GRCm39) probably benign Het
Fbf1 T A 11: 116,042,317 (GRCm39) Q511L possibly damaging Het
Fhdc1 A T 3: 84,362,158 (GRCm39) L323Q probably damaging Het
Fmnl2 T A 2: 52,995,588 (GRCm39) V437D possibly damaging Het
Foxo3 A G 10: 42,073,258 (GRCm39) S420P probably benign Het
Foxp4 C T 17: 48,186,796 (GRCm39) R378Q unknown Het
Garem2 G T 5: 30,322,172 (GRCm39) G844* probably null Het
Glmp T C 3: 88,235,177 (GRCm39) L269S probably damaging Het
Gm9915 T C 1: 42,269,881 (GRCm39) noncoding transcript Het
Gnb4 A T 3: 32,652,290 (GRCm39) D27E probably damaging Het
Gnb5 A G 9: 75,251,932 (GRCm39) probably null Het
Gpr161 T G 1: 165,133,927 (GRCm39) V63G probably damaging Het
Gsk3a T A 7: 24,929,146 (GRCm39) probably benign Het
Hapln2 T C 3: 87,931,427 (GRCm39) probably null Het
Incenp G T 19: 9,862,851 (GRCm39) T401N unknown Het
Kalrn A G 16: 33,797,894 (GRCm39) probably null Het
Kcnq3 A G 15: 65,900,472 (GRCm39) probably null Het
Kif21b T C 1: 136,098,894 (GRCm39) V1394A probably damaging Het
Klhl23 T C 2: 69,664,030 (GRCm39) C460R probably damaging Het
L3mbtl1 G A 2: 162,801,492 (GRCm39) A291T probably damaging Het
Lcp1 T C 14: 75,437,946 (GRCm39) S119P probably damaging Het
Ldhc A G 7: 46,519,175 (GRCm39) I133V probably benign Het
Lmntd2 G A 7: 140,791,972 (GRCm39) probably benign Het
Lpl A T 8: 69,349,454 (GRCm39) K327* probably null Het
Lrp1b T C 2: 40,765,081 (GRCm39) D2801G probably damaging Het
Mppe1 C A 18: 67,362,843 (GRCm39) A131S probably benign Het
Msh3 T A 13: 92,386,328 (GRCm39) probably benign Het
Msh5 A G 17: 35,252,576 (GRCm39) I377T probably damaging Het
Myo1e T C 9: 70,276,055 (GRCm39) F757L probably benign Het
Myof A T 19: 37,934,082 (GRCm39) D955E probably damaging Het
Nckap1 C T 2: 80,348,286 (GRCm39) S889N probably benign Het
Ncor2 T C 5: 125,115,982 (GRCm39) D858G probably damaging Het
Neb A T 2: 52,153,917 (GRCm39) V2398D possibly damaging Het
Nefl C G 14: 68,324,121 (GRCm39) T453R probably benign Het
Nf1 A G 11: 79,444,787 (GRCm39) N371D probably benign Het
Nhsl3 A G 4: 129,119,810 (GRCm39) probably benign Het
Nlrp4f T C 13: 65,341,905 (GRCm39) Y580C probably damaging Het
Nme8 A C 13: 19,836,492 (GRCm39) L228R probably damaging Het
Numa1 C T 7: 101,658,529 (GRCm39) A1605V probably damaging Het
Ofd1 T C X: 165,210,210 (GRCm39) Y205C probably benign Het
Or2ag12 T A 7: 106,276,877 (GRCm39) N272I probably damaging Het
Or2d3b G A 7: 106,513,453 (GRCm39) G16D probably damaging Het
Or4k77 C T 2: 111,199,421 (GRCm39) S148L probably benign Het
Or8g55 T A 9: 39,785,234 (GRCm39) I221N probably damaging Het
Or8k3 T A 2: 86,058,596 (GRCm39) T240S probably damaging Het
Pclo A G 5: 14,763,487 (GRCm39) T3987A unknown Het
Pdgfrb G A 18: 61,199,566 (GRCm39) probably benign Het
Pdxk G A 10: 78,276,988 (GRCm39) T270I probably damaging Het
Pex5 T C 6: 124,391,364 (GRCm39) E10G probably damaging Het
Pik3c2g T A 6: 139,846,112 (GRCm39) probably null Het
Pkhd1 T A 1: 20,451,747 (GRCm39) I2183F probably damaging Het
Plppr2 T C 9: 21,852,422 (GRCm39) V102A probably damaging Het
Plxnd1 T C 6: 115,939,478 (GRCm39) T1449A probably damaging Het
Pnkd T A 1: 74,325,069 (GRCm39) probably null Het
Pom121l2 A G 13: 22,167,642 (GRCm39) I638V probably damaging Het
Prag1 A G 8: 36,596,314 (GRCm39) probably null Het
Ranbp10 A G 8: 106,513,340 (GRCm39) F191L probably damaging Het
Rapgef1 T C 2: 29,623,723 (GRCm39) L824P probably damaging Het
Rec8 T C 14: 55,861,599 (GRCm39) L418P probably damaging Het
Rimbp2 T A 5: 128,874,305 (GRCm39) N429Y probably damaging Het
Rpe65 C A 3: 159,321,307 (GRCm39) T373K probably benign Het
Rpl35rt T G 1: 156,194,017 (GRCm39) *124G probably null Het
Rrn3 T C 16: 13,606,938 (GRCm39) S151P probably damaging Het
Scn7a A G 2: 66,514,633 (GRCm39) V1047A possibly damaging Het
Scn9a G T 2: 66,345,724 (GRCm39) P1123Q probably damaging Het
Secisbp2l T C 2: 125,589,430 (GRCm39) D706G probably damaging Het
Serpina5 A T 12: 104,070,116 (GRCm39) T338S probably benign Het
Sez6 G A 11: 77,844,894 (GRCm39) probably null Het
Shisa4 C T 1: 135,300,012 (GRCm39) G157D probably damaging Het
Slc1a7 G T 4: 107,825,782 (GRCm39) D14Y probably benign Het
Slc25a11 A C 11: 70,536,999 (GRCm39) L51V probably benign Het
Slit3 A G 11: 35,521,668 (GRCm39) probably null Het
Spata13 G T 14: 60,928,912 (GRCm39) G157W probably damaging Het
Spta1 T C 1: 174,067,933 (GRCm39) V2120A possibly damaging Het
Srpra T C 9: 35,124,834 (GRCm39) probably null Het
Syt6 A G 3: 103,494,736 (GRCm39) I234V probably benign Het
Thada G T 17: 84,617,470 (GRCm39) P1349T probably damaging Het
Tmem161a C T 8: 70,629,559 (GRCm39) R58W probably damaging Het
Top3b A G 16: 16,701,383 (GRCm39) I232V probably damaging Het
Tspan1 T A 4: 116,020,826 (GRCm39) Q197L possibly damaging Het
Ttc28 A C 5: 111,383,501 (GRCm39) Y1334S probably benign Het
Ubxn6 G T 17: 56,380,077 (GRCm39) N28K possibly damaging Het
Uggt1 T C 1: 36,190,862 (GRCm39) D1366G probably damaging Het
Ugp2 A G 11: 21,278,942 (GRCm39) S415P probably damaging Het
Vcan A T 13: 89,837,157 (GRCm39) S2796T probably damaging Het
Vipr2 T C 12: 116,099,826 (GRCm39) V231A probably benign Het
Vmn1r176 T C 7: 23,534,373 (GRCm39) N260S probably benign Het
Vmn1r59 A T 7: 5,457,038 (GRCm39) Y241N probably damaging Het
Vmn2r67 A T 7: 84,801,013 (GRCm39) Y308N probably benign Het
Vmn2r75 A T 7: 85,797,470 (GRCm39) M781K probably damaging Het
Vwa3a A T 7: 120,379,394 (GRCm39) I500F probably damaging Het
Zfp609 A G 9: 65,702,559 (GRCm39) V31A probably damaging Het
Zfp689 G T 7: 127,043,959 (GRCm39) Q224K probably damaging Het
Zfp81 A T 17: 33,554,475 (GRCm39) L113H probably benign Het
Other mutations in Cdc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Cdc7 APN 5 107,116,726 (GRCm39) missense probably benign
IGL01671:Cdc7 APN 5 107,131,111 (GRCm39) missense probably damaging 1.00
IGL03373:Cdc7 APN 5 107,120,785 (GRCm39) splice site probably benign
R0179:Cdc7 UTSW 5 107,112,905 (GRCm39) missense probably benign 0.02
R0563:Cdc7 UTSW 5 107,120,776 (GRCm39) splice site probably benign
R1621:Cdc7 UTSW 5 107,112,920 (GRCm39) missense probably benign
R2044:Cdc7 UTSW 5 107,130,998 (GRCm39) missense probably benign
R2993:Cdc7 UTSW 5 107,121,764 (GRCm39) missense probably benign
R3110:Cdc7 UTSW 5 107,122,564 (GRCm39) critical splice donor site probably null
R3112:Cdc7 UTSW 5 107,122,564 (GRCm39) critical splice donor site probably null
R4700:Cdc7 UTSW 5 107,121,707 (GRCm39) missense probably benign 0.00
R5396:Cdc7 UTSW 5 107,117,163 (GRCm39) splice site probably null
R6217:Cdc7 UTSW 5 107,120,660 (GRCm39) missense probably damaging 1.00
R6258:Cdc7 UTSW 5 107,117,093 (GRCm39) missense probably damaging 1.00
R6285:Cdc7 UTSW 5 107,130,925 (GRCm39) missense probably benign 0.00
R6609:Cdc7 UTSW 5 107,120,924 (GRCm39) missense probably benign 0.04
R7828:Cdc7 UTSW 5 107,120,816 (GRCm39) missense possibly damaging 0.67
R8518:Cdc7 UTSW 5 107,120,864 (GRCm39) missense probably damaging 1.00
R9748:Cdc7 UTSW 5 107,123,405 (GRCm39) missense possibly damaging 0.82
V8831:Cdc7 UTSW 5 107,116,776 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCGTATCTGGAACATGAGTCC -3'
(R):5'- TCCGTCTAAGTGTGCATCTC -3'

Sequencing Primer
(F):5'- ATCTGGAACATGAGTCCTTTTTG -3'
(R):5'- GCGCTACGGACATAACTT -3'
Posted On 2014-08-25