Mutagenetix > Incidental Mutations

Incidental Mutation 'R1970:Pik3c2g'

219690

Institutional Source

Beutler Lab

Gene Symbol

Pik3c2g

Ensembl Gene

ENSMUSG00000030228

Gene Name

phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 gamma

Synonyms

MMRRC Submission

039983-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.122) question?

Stock #

R1970 (G1)

Quality Score

208

Status

Validated

Chromosome

Chromosomal Location

139587221-139969284 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 139900386 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000151281 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087657] [ENSMUST00000087657] [ENSMUST00000111868] [ENSMUST00000218528]

Predicted Effect

probably null
Transcript: ENSMUST00000087657

SMART Domains

Protein: ENSMUSP00000084939
Gene: ENSMUSG00000030228

Domain	Start	End	E-Value	Type
PI3Kc	125	387	2.11e-109	SMART
PX	411	515	1.24e-21	SMART
C2	550	647	1.34e-7	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000087657

SMART Domains

Protein: ENSMUSP00000084939
Gene: ENSMUSG00000030228

Domain	Start	End	E-Value	Type
PI3Kc	125	387	2.11e-109	SMART
PX	411	515	1.24e-21	SMART
C2	550	647	1.34e-7	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000111868

SMART Domains

Protein: ENSMUSP00000107499
Gene: ENSMUSG00000030228

Domain	Start	End	E-Value	Type
SCOP:d1e8xa2	1	83	4e-16	SMART
PI3Ka	103	288	7.6e-29	SMART
PI3Kc	375	637	2.11e-109	SMART
PX	661	765	1.24e-21	SMART
C2	800	897	1.34e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187448

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000189374

SMART Domains

Protein: ENSMUSP00000139763
Gene: ENSMUSG00000030228

Domain	Start	End	E-Value	Type
PI3Kc	125	387	2.11e-109	SMART
PX	411	515	1.24e-21	SMART
C2	550	647	1.34e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206646

Predicted Effect

probably null
Transcript: ENSMUST00000218528

Meta Mutation Damage Score

0.9480

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 94.2%

Validation Efficiency

97% (121/125)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. This gene may play a role in several diseases, including type II diabetes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for a knock-out allelel exhibit reduced liver glucogen accumulation, hyperlipidemia, adiposity and insulin resistance with age or after consumption of a high-fat diet. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 121 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca17	A	T	17: 24,307,575	H578Q	probably benign	Het
Abcc12	A	G	8: 86,527,281	I958T	probably benign	Het
Abcg5	AATCATTTG	AG	17: 84,673,602		probably null	Het
Acap2	A	G	16: 31,133,527		probably null	Het
Adgrb1	T	C	15: 74,539,877		probably benign	Het
Akap6	T	A	12: 52,938,475	V897E	probably damaging	Het
Als2	A	T	1: 59,215,169	L343Q	probably benign	Het
Arhgap5	A	G	12: 52,542,593	I1275M	probably damaging	Het
Arnt	C	T	3: 95,448,393	S16L	possibly damaging	Het
Bglap3	C	T	3: 88,376,993		probably benign	Het
Blnk	T	C	19: 40,940,165		probably benign	Het
C1qtnf4	T	C	2: 90,889,659	M92T	probably damaging	Het
C77080	A	G	4: 129,226,017		probably benign	Het
Ccdc177	G	A	12: 80,758,712	R263C	unknown	Het
Ccdc83	T	A	7: 90,244,154	S132C	probably damaging	Het
Cdc7	A	G	5: 106,973,074		probably benign	Het
Cgnl1	T	A	9: 71,725,535	N178I	probably benign	Het
Col27a1	C	T	4: 63,273,117		probably benign	Het
Col5a1	A	T	2: 27,986,754	M822L	unknown	Het
Coro7	T	C	16: 4,633,756	I451V	probably benign	Het
Csmd3	T	C	15: 48,673,531	T92A	probably damaging	Het
Ddc	A	G	11: 11,815,292	V460A	possibly damaging	Het
Ddx4	C	T	13: 112,600,013	V608I	probably damaging	Het
Ddx60	A	T	8: 61,972,206	H676L	possibly damaging	Het
Dmtf1	T	C	5: 9,148,989	E48G	probably benign	Het
Dpf3	T	A	12: 83,325,035		probably null	Het
Dydc2	A	G	14: 41,061,903	C88R	probably benign	Het
Elovl4	A	G	9: 83,780,719	Y163H	probably damaging	Het
Enpp2	T	C	15: 54,882,982	D296G	probably damaging	Het
Fam83h	G	T	15: 76,006,570		probably benign	Het
Fbf1	T	A	11: 116,151,491	Q511L	possibly damaging	Het
Fhdc1	A	T	3: 84,454,851	L323Q	probably damaging	Het
Fmnl2	T	A	2: 53,105,576	V437D	possibly damaging	Het
Foxo3	A	G	10: 42,197,262	S420P	probably benign	Het
Foxp4	C	T	17: 47,875,871	R378Q	unknown	Het
Garem2	G	T	5: 30,117,174	G844*	probably null	Het
Glmp	T	C	3: 88,327,870	L269S	probably damaging	Het
Gm2000	T	G	1: 156,366,447	*124G	probably null	Het
Gm9915	T	C	1: 42,230,721		noncoding transcript	Het
Gnb4	A	T	3: 32,598,141	D27E	probably damaging	Het
Gnb5	A	G	9: 75,344,650		probably null	Het
Gpr161	T	G	1: 165,306,358	V63G	probably damaging	Het
Gsk3a	T	A	7: 25,229,721		probably benign	Het
Hapln2	T	C	3: 88,024,120		probably null	Het
Incenp	G	T	19: 9,885,487	T401N	unknown	Het
Kalrn	A	G	16: 33,977,524		probably null	Het
Kcnq3	A	G	15: 66,028,623		probably null	Het
Kif21b	T	C	1: 136,171,156	V1394A	probably damaging	Het
Klhl23	T	C	2: 69,833,686	C460R	probably damaging	Het
L3mbtl1	G	A	2: 162,959,572	A291T	probably damaging	Het
Lcp1	T	C	14: 75,200,506	S119P	probably damaging	Het
Ldhc	A	G	7: 46,869,751	I133V	probably benign	Het
Lmntd2	G	A	7: 141,212,059		probably benign	Het
Lpl	A	T	8: 68,896,802	K327*	probably null	Het
Lrp1b	T	C	2: 40,875,069	D2801G	probably damaging	Het
Mppe1	C	A	18: 67,229,772	A131S	probably benign	Het
Msh3	T	A	13: 92,249,820		probably benign	Het
Msh5	A	G	17: 35,033,600	I377T	probably damaging	Het
Myo1e	T	C	9: 70,368,773	F757L	probably benign	Het
Myof	A	T	19: 37,945,634	D955E	probably damaging	Het
Nckap1	C	T	2: 80,517,942	S889N	probably benign	Het
Ncor2	T	C	5: 125,038,918	D858G	probably damaging	Het
Neb	A	T	2: 52,263,905	V2398D	possibly damaging	Het
Nefl	C	G	14: 68,086,672	T453R	probably benign	Het
Nf1	A	G	11: 79,553,961	N371D	probably benign	Het
Nlrp4f	T	C	13: 65,194,091	Y580C	probably damaging	Het
Nme8	A	C	13: 19,652,322	L228R	probably damaging	Het
Numa1	C	T	7: 102,009,322	A1605V	probably damaging	Het
Ofd1	T	C	X: 166,427,214	Y205C	probably benign	Het
Olfr1047	T	A	2: 86,228,252	T240S	probably damaging	Het
Olfr1283	C	T	2: 111,369,076	S148L	probably benign	Het
Olfr1532-ps1	G	A	7: 106,914,246	G16D	probably damaging	Het
Olfr693	T	A	7: 106,677,670	N272I	probably damaging	Het
Olfr972	T	A	9: 39,873,938	I221N	probably damaging	Het
Pclo	A	G	5: 14,713,473	T3987A	unknown	Het
Pdgfrb	G	A	18: 61,066,494		probably benign	Het
Pdxk	G	A	10: 78,441,154	T270I	probably damaging	Het
Pex5	T	C	6: 124,414,405	E10G	probably damaging	Het
Pkhd1	T	A	1: 20,381,523	I2183F	probably damaging	Het
Plppr2	T	C	9: 21,941,126	V102A	probably damaging	Het
Plxnd1	T	C	6: 115,962,517	T1449A	probably damaging	Het
Pnkd	T	A	1: 74,285,910		probably null	Het
Pom121l2	A	G	13: 21,983,472	I638V	probably damaging	Het
Prag1	A	G	8: 36,129,160		probably null	Het
Ranbp10	A	G	8: 105,786,708	F191L	probably damaging	Het
Rapgef1	T	C	2: 29,733,711	L824P	probably damaging	Het
Rec8	T	C	14: 55,624,142	L418P	probably damaging	Het
Rimbp2	T	A	5: 128,797,241	N429Y	probably damaging	Het
Rpe65	C	A	3: 159,615,670	T373K	probably benign	Het
Rrn3	T	C	16: 13,789,074	S151P	probably damaging	Het
Scn7a	A	G	2: 66,684,289	V1047A	possibly damaging	Het
Scn9a	G	T	2: 66,515,380	P1123Q	probably damaging	Het
Secisbp2l	T	C	2: 125,747,510	D706G	probably damaging	Het
Serpina5	A	T	12: 104,103,857	T338S	probably benign	Het
Sez6	G	A	11: 77,954,068		probably null	Het
Shisa4	C	T	1: 135,372,274	G157D	probably damaging	Het
Slc1a7	G	T	4: 107,968,585	D14Y	probably benign	Het
Slc25a11	A	C	11: 70,646,173	L51V	probably benign	Het
Slit3	A	G	11: 35,630,841		probably null	Het
Spata13	G	T	14: 60,691,463	G157W	probably damaging	Het
Spta1	T	C	1: 174,240,367	V2120A	possibly damaging	Het
Srpr	T	C	9: 35,213,538		probably null	Het
Syt6	A	G	3: 103,587,420	I234V	probably benign	Het
Thada	G	T	17: 84,310,042	P1349T	probably damaging	Het
Tmem161a	C	T	8: 70,176,909	R58W	probably damaging	Het
Top3b	A	G	16: 16,883,519	I232V	probably damaging	Het
Tspan1	T	A	4: 116,163,629	Q197L	possibly damaging	Het
Ttc28	A	C	5: 111,235,635	Y1334S	probably benign	Het
Ubxn6	G	T	17: 56,073,077	N28K	possibly damaging	Het
Uggt1	T	C	1: 36,151,781	D1366G	probably damaging	Het
Ugp2	A	G	11: 21,328,942	S415P	probably damaging	Het
Vcan	A	T	13: 89,689,038	S2796T	probably damaging	Het
Vipr2	T	C	12: 116,136,206	V231A	probably benign	Het
Vmn1r176	T	C	7: 23,834,948	N260S	probably benign	Het
Vmn1r59	A	T	7: 5,454,039	Y241N	probably damaging	Het
Vmn2r67	A	T	7: 85,151,805	Y308N	probably benign	Het
Vmn2r75	A	T	7: 86,148,262	M781K	probably damaging	Het
Vwa3a	A	T	7: 120,780,171	I500F	probably damaging	Het
Zfp609	A	G	9: 65,795,277	V31A	probably damaging	Het
Zfp689	G	T	7: 127,444,787	Q224K	probably damaging	Het
Zfp81	A	T	17: 33,335,501	L113H	probably benign	Het

Other mutations in Pik3c2g

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Pik3c2g	APN	6	139896125	missense	probably damaging	1.00
IGL01355:Pik3c2g	APN	6	139852857	missense	probably damaging	0.98
IGL01579:Pik3c2g	APN	6	139754741	nonsense	probably null
IGL01580:Pik3c2g	APN	6	139622516	missense	probably damaging	0.99
IGL01587:Pik3c2g	APN	6	139754741	nonsense	probably null
IGL01813:Pik3c2g	APN	6	139622409	missense	possibly damaging	0.55
IGL02218:Pik3c2g	APN	6	139860355	missense	probably damaging	1.00
IGL02479:Pik3c2g	APN	6	139918004	missense	probably benign	0.40
IGL02480:Pik3c2g	APN	6	139852800	missense	probably damaging	1.00
IGL02721:Pik3c2g	APN	6	139736973	missense	probably benign	0.15
IGL02967:Pik3c2g	APN	6	139967828	missense	probably damaging	0.98
IGL03221:Pik3c2g	APN	6	139772407	critical splice acceptor site	probably null
FR4304:Pik3c2g	UTSW	6	139635656	frame shift	probably null
FR4340:Pik3c2g	UTSW	6	139635656	frame shift	probably null
FR4976:Pik3c2g	UTSW	6	139635654	frame shift	probably null
IGL02837:Pik3c2g	UTSW	6	139626564	nonsense	probably null
PIT4531001:Pik3c2g	UTSW	6	139859370	missense
R0002:Pik3c2g	UTSW	6	139768745	missense	probably benign	0.08
R0081:Pik3c2g	UTSW	6	139957793	missense	probably benign	0.05
R0098:Pik3c2g	UTSW	6	139662443	missense	unknown
R0719:Pik3c2g	UTSW	6	139629725	missense	probably damaging	1.00
R0740:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R0837:Pik3c2g	UTSW	6	139957699	splice site	probably benign
R0840:Pik3c2g	UTSW	6	139896072	missense	probably damaging	1.00
R1306:Pik3c2g	UTSW	6	139772428	missense	probably benign
R1501:Pik3c2g	UTSW	6	139844070	critical splice donor site	probably null
R1591:Pik3c2g	UTSW	6	139748178	missense	probably benign	0.00
R1666:Pik3c2g	UTSW	6	139635636	intron	probably benign
R1907:Pik3c2g	UTSW	6	139844042	missense	probably damaging	1.00
R1982:Pik3c2g	UTSW	6	139622548	missense	probably damaging	0.97
R2171:Pik3c2g	UTSW	6	139855286	nonsense	probably null
R2188:Pik3c2g	UTSW	6	139852874	missense	probably damaging	1.00
R3777:Pik3c2g	UTSW	6	139622387	missense	probably damaging	1.00
R3778:Pik3c2g	UTSW	6	139622387	missense	probably damaging	1.00
R3965:Pik3c2g	UTSW	6	139855292	missense	possibly damaging	0.90
R4076:Pik3c2g	UTSW	6	139852863	missense	probably damaging	1.00
R4078:Pik3c2g	UTSW	6	139635610	intron	probably benign
R4108:Pik3c2g	UTSW	6	139730370	missense	probably benign	0.00
R4461:Pik3c2g	UTSW	6	139841681	intron	probably benign
R4474:Pik3c2g	UTSW	6	139633751	missense	probably damaging	0.99
R4509:Pik3c2g	UTSW	6	139720006	missense	probably benign	0.25
R4646:Pik3c2g	UTSW	6	139720018	missense	probably benign	0.05
R4732:Pik3c2g	UTSW	6	139935985	missense	probably benign	0.28
R4733:Pik3c2g	UTSW	6	139935985	missense	probably benign	0.28
R4854:Pik3c2g	UTSW	6	139768779	missense	probably damaging	1.00
R4928:Pik3c2g	UTSW	6	139967802	missense	possibly damaging	0.88
R4959:Pik3c2g	UTSW	6	139843931	missense	possibly damaging	0.65
R4973:Pik3c2g	UTSW	6	139843931	missense	possibly damaging	0.65
R5032:Pik3c2g	UTSW	6	139896202	missense	probably benign	0.00
R5071:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5072:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5073:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5074:Pik3c2g	UTSW	6	139720147	missense	probably null	0.00
R5107:Pik3c2g	UTSW	6	139635625	intron	probably benign
R5186:Pik3c2g	UTSW	6	139622018	missense	probably damaging	1.00
R5253:Pik3c2g	UTSW	6	139896257	critical splice donor site	probably null
R5359:Pik3c2g	UTSW	6	139622123	missense	probably damaging	1.00
R5394:Pik3c2g	UTSW	6	139720082	missense	probably benign
R5417:Pik3c2g	UTSW	6	139736943	missense	probably benign
R5435:Pik3c2g	UTSW	6	139715855	splice site	probably null
R5580:Pik3c2g	UTSW	6	139626533	missense	probably damaging	0.99
R5664:Pik3c2g	UTSW	6	139737007	missense	probably damaging	0.98
R5908:Pik3c2g	UTSW	6	139768710	missense	probably damaging	1.00
R5914:Pik3c2g	UTSW	6	139622479	missense	probably benign	0.00
R6046:Pik3c2g	UTSW	6	139622139	missense	probably damaging	0.96
R6046:Pik3c2g	UTSW	6	139896792	missense	probably damaging	1.00
R6298:Pik3c2g	UTSW	6	139626563	missense	probably damaging	1.00
R6382:Pik3c2g	UTSW	6	139719998	missense	possibly damaging	0.88
R6480:Pik3c2g	UTSW	6	139730469	missense	probably benign	0.27
R6917:Pik3c2g	UTSW	6	139896173	missense	probably benign	0.00
R6929:Pik3c2g	UTSW	6	139957776	missense	possibly damaging	0.67
R7022:Pik3c2g	UTSW	6	139622063	missense	possibly damaging	0.82
R7144:Pik3c2g	UTSW	6	139629870	missense	probably damaging	1.00
R7213:Pik3c2g	UTSW	6	139860264	missense
R7215:Pik3c2g	UTSW	6	139754863	missense
R7332:Pik3c2g	UTSW	6	139896255	missense
R7357:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R7359:Pik3c2g	UTSW	6	139967894	missense	unknown
R7385:Pik3c2g	UTSW	6	139855353	missense
R7455:Pik3c2g	UTSW	6	139967917	missense	unknown
R7651:Pik3c2g	UTSW	6	139622072	missense	possibly damaging	0.85
R7888:Pik3c2g	UTSW	6	139896744	missense
R7923:Pik3c2g	UTSW	6	139633793	critical splice donor site	probably null
R7964:Pik3c2g	UTSW	6	139882060	missense
R8005:Pik3c2g	UTSW	6	139622069	missense	probably benign	0.01
R8371:Pik3c2g	UTSW	6	139936056	missense	unknown
RF015:Pik3c2g	UTSW	6	139754771	missense
RF032:Pik3c2g	UTSW	6	139635658	frame shift	probably null
X0024:Pik3c2g	UTSW	6	139860258	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGGTGACTTTGTTACCAGCC -3'
(R):5'- GTACAGTGGTGCACATCTAGGC -3'

Sequencing Primer
(F):5'- CTTTGTTACCAGCCAAAGGAG -3'
(R):5'- GTGCACATCTAGGCAATGTG -3'

Posted On

2014-08-25