Incidental Mutation 'R1970:Vwa3a'
ID 219711
Institutional Source Beutler Lab
Gene Symbol Vwa3a
Ensembl Gene ENSMUSG00000030889
Gene Name von Willebrand factor A domain containing 3A
Synonyms E030013G06Rik
MMRRC Submission 039983-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1970 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 120338541-120404965 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 120379394 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 500 (I500F)
Ref Sequence ENSEMBL: ENSMUSP00000133029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033180] [ENSMUST00000165055] [ENSMUST00000166668] [ENSMUST00000167213] [ENSMUST00000168430] [ENSMUST00000168600]
AlphaFold Q3UVV9
Predicted Effect probably damaging
Transcript: ENSMUST00000033180
AA Change: I500F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033180
Gene: ENSMUSG00000030889
AA Change: I500F

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 6.3e-30 PFAM
Pfam:VWA_3 483 634 1.2e-17 PFAM
VWA 921 1092 1.89e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165055
SMART Domains Protein: ENSMUSP00000129672
Gene: ENSMUSG00000030889

DomainStartEndE-ValueType
Blast:VWA 1 162 1e-94 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000166668
AA Change: I500F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129136
Gene: ENSMUSG00000030889
AA Change: I500F

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 1.3e-28 PFAM
Pfam:VWA_3 483 633 5.2e-17 PFAM
VWA 921 1092 1.89e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167213
AA Change: I500F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133029
Gene: ENSMUSG00000030889
AA Change: I500F

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 1.3e-28 PFAM
Pfam:VWA_3 483 633 5.2e-17 PFAM
VWA 921 1092 1.89e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168430
Predicted Effect probably benign
Transcript: ENSMUST00000168600
AA Change: I500F

PolyPhen 2 Score 0.288 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000132372
Gene: ENSMUSG00000030889
AA Change: I500F

DomainStartEndE-ValueType
Pfam:VWA_3 142 297 8.3e-29 PFAM
Pfam:VWA_3 483 609 5.3e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207721
Meta Mutation Damage Score 0.2114 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency 97% (121/125)
Allele List at MGI
Other mutations in this stock
Total: 121 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A T 17: 24,526,549 (GRCm39) H578Q probably benign Het
Abcc12 A G 8: 87,253,910 (GRCm39) I958T probably benign Het
Abcg5 AATCATTTG AG 17: 84,981,030 (GRCm39) probably null Het
Acap2 A G 16: 30,952,345 (GRCm39) probably null Het
Adgrb1 T C 15: 74,411,726 (GRCm39) probably benign Het
Akap6 T A 12: 52,985,258 (GRCm39) V897E probably damaging Het
Als2 A T 1: 59,254,328 (GRCm39) L343Q probably benign Het
Arhgap5 A G 12: 52,589,376 (GRCm39) I1275M probably damaging Het
Arnt C T 3: 95,355,704 (GRCm39) S16L possibly damaging Het
Bglap3 C T 3: 88,284,300 (GRCm39) probably benign Het
Blnk T C 19: 40,928,609 (GRCm39) probably benign Het
C1qtnf4 T C 2: 90,720,003 (GRCm39) M92T probably damaging Het
Ccdc177 G A 12: 80,805,486 (GRCm39) R263C unknown Het
Ccdc83 T A 7: 89,893,362 (GRCm39) S132C probably damaging Het
Cdc7 A G 5: 107,120,940 (GRCm39) probably benign Het
Cgnl1 T A 9: 71,632,817 (GRCm39) N178I probably benign Het
Col27a1 C T 4: 63,191,354 (GRCm39) probably benign Het
Col5a1 A T 2: 27,876,766 (GRCm39) M822L unknown Het
Coro7 T C 16: 4,451,620 (GRCm39) I451V probably benign Het
Csmd3 T C 15: 48,536,927 (GRCm39) T92A probably damaging Het
Ddc A G 11: 11,765,292 (GRCm39) V460A possibly damaging Het
Ddx4 C T 13: 112,736,547 (GRCm39) V608I probably damaging Het
Ddx60 A T 8: 62,425,240 (GRCm39) H676L possibly damaging Het
Dmtf1 T C 5: 9,198,989 (GRCm39) E48G probably benign Het
Dpf3 T A 12: 83,371,809 (GRCm39) probably null Het
Dydc2 A G 14: 40,783,860 (GRCm39) C88R probably benign Het
Elovl4 A G 9: 83,662,772 (GRCm39) Y163H probably damaging Het
Enpp2 T C 15: 54,746,378 (GRCm39) D296G probably damaging Het
Fam83h G T 15: 75,878,419 (GRCm39) probably benign Het
Fbf1 T A 11: 116,042,317 (GRCm39) Q511L possibly damaging Het
Fhdc1 A T 3: 84,362,158 (GRCm39) L323Q probably damaging Het
Fmnl2 T A 2: 52,995,588 (GRCm39) V437D possibly damaging Het
Foxo3 A G 10: 42,073,258 (GRCm39) S420P probably benign Het
Foxp4 C T 17: 48,186,796 (GRCm39) R378Q unknown Het
Garem2 G T 5: 30,322,172 (GRCm39) G844* probably null Het
Glmp T C 3: 88,235,177 (GRCm39) L269S probably damaging Het
Gm9915 T C 1: 42,269,881 (GRCm39) noncoding transcript Het
Gnb4 A T 3: 32,652,290 (GRCm39) D27E probably damaging Het
Gnb5 A G 9: 75,251,932 (GRCm39) probably null Het
Gpr161 T G 1: 165,133,927 (GRCm39) V63G probably damaging Het
Gsk3a T A 7: 24,929,146 (GRCm39) probably benign Het
Hapln2 T C 3: 87,931,427 (GRCm39) probably null Het
Incenp G T 19: 9,862,851 (GRCm39) T401N unknown Het
Kalrn A G 16: 33,797,894 (GRCm39) probably null Het
Kcnq3 A G 15: 65,900,472 (GRCm39) probably null Het
Kif21b T C 1: 136,098,894 (GRCm39) V1394A probably damaging Het
Klhl23 T C 2: 69,664,030 (GRCm39) C460R probably damaging Het
L3mbtl1 G A 2: 162,801,492 (GRCm39) A291T probably damaging Het
Lcp1 T C 14: 75,437,946 (GRCm39) S119P probably damaging Het
Ldhc A G 7: 46,519,175 (GRCm39) I133V probably benign Het
Lmntd2 G A 7: 140,791,972 (GRCm39) probably benign Het
Lpl A T 8: 69,349,454 (GRCm39) K327* probably null Het
Lrp1b T C 2: 40,765,081 (GRCm39) D2801G probably damaging Het
Mppe1 C A 18: 67,362,843 (GRCm39) A131S probably benign Het
Msh3 T A 13: 92,386,328 (GRCm39) probably benign Het
Msh5 A G 17: 35,252,576 (GRCm39) I377T probably damaging Het
Myo1e T C 9: 70,276,055 (GRCm39) F757L probably benign Het
Myof A T 19: 37,934,082 (GRCm39) D955E probably damaging Het
Nckap1 C T 2: 80,348,286 (GRCm39) S889N probably benign Het
Ncor2 T C 5: 125,115,982 (GRCm39) D858G probably damaging Het
Neb A T 2: 52,153,917 (GRCm39) V2398D possibly damaging Het
Nefl C G 14: 68,324,121 (GRCm39) T453R probably benign Het
Nf1 A G 11: 79,444,787 (GRCm39) N371D probably benign Het
Nhsl3 A G 4: 129,119,810 (GRCm39) probably benign Het
Nlrp4f T C 13: 65,341,905 (GRCm39) Y580C probably damaging Het
Nme8 A C 13: 19,836,492 (GRCm39) L228R probably damaging Het
Numa1 C T 7: 101,658,529 (GRCm39) A1605V probably damaging Het
Ofd1 T C X: 165,210,210 (GRCm39) Y205C probably benign Het
Or2ag12 T A 7: 106,276,877 (GRCm39) N272I probably damaging Het
Or2d3b G A 7: 106,513,453 (GRCm39) G16D probably damaging Het
Or4k77 C T 2: 111,199,421 (GRCm39) S148L probably benign Het
Or8g55 T A 9: 39,785,234 (GRCm39) I221N probably damaging Het
Or8k3 T A 2: 86,058,596 (GRCm39) T240S probably damaging Het
Pclo A G 5: 14,763,487 (GRCm39) T3987A unknown Het
Pdgfrb G A 18: 61,199,566 (GRCm39) probably benign Het
Pdxk G A 10: 78,276,988 (GRCm39) T270I probably damaging Het
Pex5 T C 6: 124,391,364 (GRCm39) E10G probably damaging Het
Pik3c2g T A 6: 139,846,112 (GRCm39) probably null Het
Pkhd1 T A 1: 20,451,747 (GRCm39) I2183F probably damaging Het
Plppr2 T C 9: 21,852,422 (GRCm39) V102A probably damaging Het
Plxnd1 T C 6: 115,939,478 (GRCm39) T1449A probably damaging Het
Pnkd T A 1: 74,325,069 (GRCm39) probably null Het
Pom121l2 A G 13: 22,167,642 (GRCm39) I638V probably damaging Het
Prag1 A G 8: 36,596,314 (GRCm39) probably null Het
Ranbp10 A G 8: 106,513,340 (GRCm39) F191L probably damaging Het
Rapgef1 T C 2: 29,623,723 (GRCm39) L824P probably damaging Het
Rec8 T C 14: 55,861,599 (GRCm39) L418P probably damaging Het
Rimbp2 T A 5: 128,874,305 (GRCm39) N429Y probably damaging Het
Rpe65 C A 3: 159,321,307 (GRCm39) T373K probably benign Het
Rpl35rt T G 1: 156,194,017 (GRCm39) *124G probably null Het
Rrn3 T C 16: 13,606,938 (GRCm39) S151P probably damaging Het
Scn7a A G 2: 66,514,633 (GRCm39) V1047A possibly damaging Het
Scn9a G T 2: 66,345,724 (GRCm39) P1123Q probably damaging Het
Secisbp2l T C 2: 125,589,430 (GRCm39) D706G probably damaging Het
Serpina5 A T 12: 104,070,116 (GRCm39) T338S probably benign Het
Sez6 G A 11: 77,844,894 (GRCm39) probably null Het
Shisa4 C T 1: 135,300,012 (GRCm39) G157D probably damaging Het
Slc1a7 G T 4: 107,825,782 (GRCm39) D14Y probably benign Het
Slc25a11 A C 11: 70,536,999 (GRCm39) L51V probably benign Het
Slit3 A G 11: 35,521,668 (GRCm39) probably null Het
Spata13 G T 14: 60,928,912 (GRCm39) G157W probably damaging Het
Spta1 T C 1: 174,067,933 (GRCm39) V2120A possibly damaging Het
Srpra T C 9: 35,124,834 (GRCm39) probably null Het
Syt6 A G 3: 103,494,736 (GRCm39) I234V probably benign Het
Thada G T 17: 84,617,470 (GRCm39) P1349T probably damaging Het
Tmem161a C T 8: 70,629,559 (GRCm39) R58W probably damaging Het
Top3b A G 16: 16,701,383 (GRCm39) I232V probably damaging Het
Tspan1 T A 4: 116,020,826 (GRCm39) Q197L possibly damaging Het
Ttc28 A C 5: 111,383,501 (GRCm39) Y1334S probably benign Het
Ubxn6 G T 17: 56,380,077 (GRCm39) N28K possibly damaging Het
Uggt1 T C 1: 36,190,862 (GRCm39) D1366G probably damaging Het
Ugp2 A G 11: 21,278,942 (GRCm39) S415P probably damaging Het
Vcan A T 13: 89,837,157 (GRCm39) S2796T probably damaging Het
Vipr2 T C 12: 116,099,826 (GRCm39) V231A probably benign Het
Vmn1r176 T C 7: 23,534,373 (GRCm39) N260S probably benign Het
Vmn1r59 A T 7: 5,457,038 (GRCm39) Y241N probably damaging Het
Vmn2r67 A T 7: 84,801,013 (GRCm39) Y308N probably benign Het
Vmn2r75 A T 7: 85,797,470 (GRCm39) M781K probably damaging Het
Zfp609 A G 9: 65,702,559 (GRCm39) V31A probably damaging Het
Zfp689 G T 7: 127,043,959 (GRCm39) Q224K probably damaging Het
Zfp81 A T 17: 33,554,475 (GRCm39) L113H probably benign Het
Other mutations in Vwa3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01584:Vwa3a APN 7 120,383,197 (GRCm39) missense probably benign 0.09
IGL01807:Vwa3a APN 7 120,374,729 (GRCm39) splice site probably null
IGL02850:Vwa3a APN 7 120,372,515 (GRCm39) missense probably benign 0.00
IGL03253:Vwa3a APN 7 120,378,092 (GRCm39) missense probably benign 0.03
PIT4812001:Vwa3a UTSW 7 120,375,356 (GRCm39) missense probably damaging 1.00
R0026:Vwa3a UTSW 7 120,379,434 (GRCm39) missense probably damaging 1.00
R0114:Vwa3a UTSW 7 120,374,603 (GRCm39) missense probably benign 0.06
R1145:Vwa3a UTSW 7 120,392,566 (GRCm39) missense probably damaging 0.99
R1145:Vwa3a UTSW 7 120,392,566 (GRCm39) missense probably damaging 0.99
R1306:Vwa3a UTSW 7 120,399,613 (GRCm39) missense possibly damaging 0.49
R1355:Vwa3a UTSW 7 120,383,334 (GRCm39) missense probably damaging 1.00
R1412:Vwa3a UTSW 7 120,379,377 (GRCm39) missense probably damaging 1.00
R1466:Vwa3a UTSW 7 120,367,388 (GRCm39) missense probably damaging 1.00
R1466:Vwa3a UTSW 7 120,367,388 (GRCm39) missense probably damaging 1.00
R1584:Vwa3a UTSW 7 120,367,388 (GRCm39) missense probably damaging 1.00
R1686:Vwa3a UTSW 7 120,379,371 (GRCm39) missense probably damaging 1.00
R1710:Vwa3a UTSW 7 120,403,254 (GRCm39) splice site probably null
R1717:Vwa3a UTSW 7 120,392,609 (GRCm39) missense probably benign
R1834:Vwa3a UTSW 7 120,389,359 (GRCm39) missense probably benign 0.06
R1912:Vwa3a UTSW 7 120,394,850 (GRCm39) missense probably damaging 1.00
R1978:Vwa3a UTSW 7 120,358,177 (GRCm39) missense probably null 0.00
R2034:Vwa3a UTSW 7 120,381,868 (GRCm39) nonsense probably null
R2059:Vwa3a UTSW 7 120,358,172 (GRCm39) missense probably damaging 0.98
R2120:Vwa3a UTSW 7 120,391,641 (GRCm39) missense probably benign
R2408:Vwa3a UTSW 7 120,372,517 (GRCm39) missense probably benign 0.00
R3423:Vwa3a UTSW 7 120,398,334 (GRCm39) missense probably damaging 1.00
R3744:Vwa3a UTSW 7 120,351,817 (GRCm39) missense probably benign
R3816:Vwa3a UTSW 7 120,399,602 (GRCm39) missense probably benign 0.29
R3849:Vwa3a UTSW 7 120,361,687 (GRCm39) nonsense probably null
R3904:Vwa3a UTSW 7 120,358,099 (GRCm39) missense probably benign
R4031:Vwa3a UTSW 7 120,367,455 (GRCm39) critical splice donor site probably null
R4408:Vwa3a UTSW 7 120,378,149 (GRCm39) missense probably benign 0.16
R4628:Vwa3a UTSW 7 120,392,598 (GRCm39) missense probably benign 0.05
R4629:Vwa3a UTSW 7 120,392,598 (GRCm39) missense probably benign 0.05
R4652:Vwa3a UTSW 7 120,378,138 (GRCm39) missense probably damaging 0.96
R4884:Vwa3a UTSW 7 120,390,924 (GRCm39) missense probably benign
R4948:Vwa3a UTSW 7 120,375,487 (GRCm39) missense probably damaging 0.98
R5112:Vwa3a UTSW 7 120,383,208 (GRCm39) missense probably damaging 1.00
R5385:Vwa3a UTSW 7 120,389,365 (GRCm39) missense possibly damaging 0.91
R5386:Vwa3a UTSW 7 120,389,365 (GRCm39) missense possibly damaging 0.91
R5579:Vwa3a UTSW 7 120,367,396 (GRCm39) missense probably benign 0.29
R5587:Vwa3a UTSW 7 120,379,458 (GRCm39) missense probably damaging 1.00
R5639:Vwa3a UTSW 7 120,389,366 (GRCm39) missense probably damaging 0.99
R6102:Vwa3a UTSW 7 120,375,361 (GRCm39) splice site probably null
R6239:Vwa3a UTSW 7 120,393,457 (GRCm39) missense probably benign 0.00
R6279:Vwa3a UTSW 7 120,381,623 (GRCm39) missense probably damaging 0.98
R6298:Vwa3a UTSW 7 120,394,874 (GRCm39) missense probably benign 0.01
R6300:Vwa3a UTSW 7 120,381,623 (GRCm39) missense probably damaging 0.98
R6336:Vwa3a UTSW 7 120,361,646 (GRCm39) missense possibly damaging 0.93
R6907:Vwa3a UTSW 7 120,391,804 (GRCm39) unclassified probably benign
R7135:Vwa3a UTSW 7 120,372,253 (GRCm39) missense possibly damaging 0.69
R7215:Vwa3a UTSW 7 120,394,853 (GRCm39) missense possibly damaging 0.83
R7282:Vwa3a UTSW 7 120,385,688 (GRCm39) missense probably benign 0.03
R7351:Vwa3a UTSW 7 120,375,559 (GRCm39) missense probably damaging 0.99
R7406:Vwa3a UTSW 7 120,378,138 (GRCm39) missense probably damaging 0.96
R7557:Vwa3a UTSW 7 120,394,841 (GRCm39) missense possibly damaging 0.90
R7612:Vwa3a UTSW 7 120,351,838 (GRCm39) missense probably null 0.47
R7699:Vwa3a UTSW 7 120,351,841 (GRCm39) missense probably damaging 1.00
R7823:Vwa3a UTSW 7 120,372,185 (GRCm39) missense probably damaging 1.00
R8074:Vwa3a UTSW 7 120,398,321 (GRCm39) missense probably benign 0.00
R8730:Vwa3a UTSW 7 120,381,910 (GRCm39) missense probably damaging 0.97
R8768:Vwa3a UTSW 7 120,375,299 (GRCm39) missense probably damaging 1.00
R8941:Vwa3a UTSW 7 120,375,311 (GRCm39) missense probably benign 0.00
R9116:Vwa3a UTSW 7 120,366,470 (GRCm39) missense
R9134:Vwa3a UTSW 7 120,377,659 (GRCm39) missense probably damaging 0.96
R9264:Vwa3a UTSW 7 120,374,687 (GRCm39) missense probably benign
R9450:Vwa3a UTSW 7 120,403,253 (GRCm39) critical splice donor site probably null
R9464:Vwa3a UTSW 7 120,385,682 (GRCm39) missense possibly damaging 0.84
R9792:Vwa3a UTSW 7 120,383,307 (GRCm39) missense probably damaging 1.00
R9793:Vwa3a UTSW 7 120,383,307 (GRCm39) missense probably damaging 1.00
V7732:Vwa3a UTSW 7 120,378,172 (GRCm39) splice site probably benign
X0019:Vwa3a UTSW 7 120,367,432 (GRCm39) missense probably damaging 0.99
Z1177:Vwa3a UTSW 7 120,358,356 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCACAGAGATTCTTGGCCG -3'
(R):5'- ATCTCCCGAGTCAGATAAACTG -3'

Sequencing Primer
(F):5'- CCGTCTATGAGTTTGGCTAGCAAAAG -3'
(R):5'- AACTGATGTGCACCTTAGGATGC -3'
Posted On 2014-08-25