Incidental Mutation 'R0136:Arg2'
ID21973
Institutional Source Beutler Lab
Gene Symbol Arg2
Ensembl Gene ENSMUSG00000021125
Gene Namearginase type II
SynonymsAII
MMRRC Submission 038421-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0136 (G1)
Quality Score225
Status Validated (trace)
Chromosome12
Chromosomal Location79130777-79156301 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79150006 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 167 (L167P)
Ref Sequence ENSEMBL: ENSMUSP00000021550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021550]
Predicted Effect probably damaging
Transcript: ENSMUST00000021550
AA Change: L167P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021550
Gene: ENSMUSG00000021125
AA Change: L167P

DomainStartEndE-ValueType
Pfam:Arginase 24 324 7.4e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218917
Meta Mutation Damage Score 0.7749 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.3%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 89% (56/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arginase catalyzes the hydrolysis of arginine to ornithine and urea. At least two isoforms of mammalian arginase exists (types I and II) which differ in their tissue distribution, subcellular localization, immunologic crossreactivity and physiologic function. The type II isoform encoded by this gene, is located in the mitochondria and expressed in extra-hepatic tissues, especially kidney. The physiologic role of this isoform is poorly understood; it is thought to play a role in nitric oxide and polyamine metabolism. Transcript variants of the type II gene resulting from the use of alternative polyadenylation sites have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in elevated plasma arginine concentrations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap4b1 T C 3: 103,809,946 M1T probably null Het
Atxn1 A G 13: 45,567,169 S417P probably damaging Het
Baz2b A G 2: 59,901,954 V1949A probably benign Het
Bcl3 A G 7: 19,809,569 V324A probably damaging Het
Btbd10 A T 7: 113,329,878 S230T possibly damaging Het
Camta1 A G 4: 151,078,969 S1479P probably damaging Het
Cd69 C T 6: 129,270,062 S64N probably benign Het
Col5a1 T C 2: 28,024,831 L153P probably damaging Het
Crat C A 2: 30,407,030 V304L probably benign Het
Csmd3 T C 15: 47,847,131 T1687A probably benign Het
Dnah1 C T 14: 31,276,158 G2574D probably damaging Het
Fau T C 19: 6,059,180 V86A possibly damaging Het
Garem1 T G 18: 21,129,991 S589R probably damaging Het
Gbp3 T G 3: 142,564,101 probably null Het
Gin1 T A 1: 97,783,016 S141R possibly damaging Het
Gtf2h1 A T 7: 46,815,416 Q419L possibly damaging Het
Hipk3 A G 2: 104,439,293 I517T probably benign Het
Hivep2 T C 10: 14,131,878 S1407P probably benign Het
Hnrnpk G T 13: 58,395,177 D211E probably benign Het
Hnrnpul2 T C 19: 8,826,801 L588P probably damaging Het
Il18rap A T 1: 40,525,058 H112L probably benign Het
Itgb1 T G 8: 128,722,854 Y585D possibly damaging Het
Kmt2d C T 15: 98,854,278 probably benign Het
Map7d1 A T 4: 126,236,631 probably null Het
Me2 A G 18: 73,770,673 S575P probably benign Het
Med13l A G 5: 118,724,050 T353A probably benign Het
Mgat4b T C 11: 50,231,081 V143A possibly damaging Het
Mlxip T A 5: 123,442,306 W211R probably damaging Het
Morc2a T G 11: 3,685,907 probably null Het
Muc4 A T 16: 32,750,195 probably benign Het
Ndufa10 A T 1: 92,463,128 Y233* probably null Het
Nek8 C T 11: 78,171,207 S237N probably benign Het
Neto1 G A 18: 86,461,320 R211Q probably benign Het
Nfatc2ip A G 7: 126,391,335 S165P probably benign Het
Nsd2 A G 5: 33,855,536 K404E possibly damaging Het
Nsd3 G T 8: 25,659,854 E352* probably null Het
Nudt9 A G 5: 104,047,106 T23A probably benign Het
Olfr394 T C 11: 73,887,785 M196V probably benign Het
Olfr394 C T 11: 73,887,830 V181I probably benign Het
Olfr983 A G 9: 40,092,019 *312Q probably null Het
Patj C A 4: 98,667,648 Q297K probably damaging Het
Pelo A T 13: 115,088,903 C40* probably null Het
Pnpla3 G A 15: 84,174,478 probably null Het
Pramel1 C A 4: 143,397,446 N230K probably damaging Het
Psg20 A C 7: 18,682,507 L228R probably damaging Het
Rsph10b T C 5: 143,959,821 F44L probably benign Het
Sept2 G A 1: 93,507,050 G358R possibly damaging Het
Slamf7 G A 1: 171,648,931 probably benign Het
Slc12a8 A G 16: 33,608,213 D297G probably damaging Het
Slc17a5 G A 9: 78,578,674 A43V probably damaging Het
Slc22a1 A T 17: 12,662,596 F335L probably benign Het
Slc26a5 T C 5: 21,834,347 N216S probably damaging Het
Snrnp27 T C 6: 86,676,205 S144G probably benign Het
Spata20 T A 11: 94,480,609 D643V probably damaging Het
Spata24 T C 18: 35,660,462 K99R probably damaging Het
Taar5 A G 10: 23,971,709 Y335C probably damaging Het
Tpr A G 1: 150,430,595 H1540R probably benign Het
Vmn1r27 A G 6: 58,215,719 F100S possibly damaging Het
Vmn2r37 A T 7: 9,217,783 Y360* probably null Het
Ybx1 C A 4: 119,282,354 R36L possibly damaging Het
Zfp369 A G 13: 65,297,202 K720E probably benign Het
Zfp599 A G 9: 22,249,742 S376P probably benign Het
Zic2 A G 14: 122,476,541 E289G probably damaging Het
Zzef1 T C 11: 72,821,851 V199A probably benign Het
Other mutations in Arg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Arg2 APN 12 79149859 splice site probably benign
IGL02494:Arg2 APN 12 79151923 missense probably benign 0.00
IGL02512:Arg2 APN 12 79147743 missense probably benign 0.01
IGL02543:Arg2 APN 12 79150759 missense probably benign 0.02
IGL02974:Arg2 APN 12 79150792 missense probably damaging 1.00
IGL03106:Arg2 APN 12 79149891 missense probably damaging 0.99
IGL03240:Arg2 APN 12 79131831 splice site probably null
R0119:Arg2 UTSW 12 79147612 missense probably damaging 1.00
R0299:Arg2 UTSW 12 79147612 missense probably damaging 1.00
R1856:Arg2 UTSW 12 79147662 missense probably benign
R1863:Arg2 UTSW 12 79150020 nonsense probably null
R4369:Arg2 UTSW 12 79149972 missense probably damaging 0.99
R4901:Arg2 UTSW 12 79147711 missense probably damaging 1.00
R7251:Arg2 UTSW 12 79150798 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCTCACTGTAACCCAGCCTCAG -3'
(R):5'- TGTGTTTAGAGTGTGGCCTCCACC -3'

Sequencing Primer
(F):5'- AGGCTAGACCCTGACTTTGC -3'
(R):5'- AGTCCTTGGGCTATGGAAATACC -3'
Posted On2013-04-12