Mutagenetix > Incidental Mutations

Incidental Mutation 'R0136:Arg2'

21973

Institutional Source

Beutler Lab

Gene Symbol

Arg2

Ensembl Gene

ENSMUSG00000021125

Gene Name

arginase type II

Synonyms

AII

MMRRC Submission

038421-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0136 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

79130777-79156301 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 79150006 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 167 (L167P)

Ref Sequence

ENSEMBL: ENSMUSP00000021550 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021550]

Predicted Effect

probably damaging
Transcript: ENSMUST00000021550
AA Change: L167P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000021550
Gene: ENSMUSG00000021125
AA Change: L167P

Domain	Start	End	E-Value	Type
Pfam:Arginase	24	324	7.4e-80	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218917

Meta Mutation Damage Score

0.7749

Coding Region Coverage

1x: 99.0%
3x: 98.3%
10x: 96.5%
20x: 93.3%

Validation Efficiency

89% (56/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arginase catalyzes the hydrolysis of arginine to ornithine and urea. At least two isoforms of mammalian arginase exists (types I and II) which differ in their tissue distribution, subcellular localization, immunologic crossreactivity and physiologic function. The type II isoform encoded by this gene, is located in the mitochondria and expressed in extra-hepatic tissues, especially kidney. The physiologic role of this isoform is poorly understood; it is thought to play a role in nitric oxide and polyamine metabolism. Transcript variants of the type II gene resulting from the use of alternative polyadenylation sites have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in elevated plasma arginine concentrations. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ap4b1	T	C	3: 103,809,946	M1T	probably null	Het
Atxn1	A	G	13: 45,567,169	S417P	probably damaging	Het
Baz2b	A	G	2: 59,901,954	V1949A	probably benign	Het
Bcl3	A	G	7: 19,809,569	V324A	probably damaging	Het
Btbd10	A	T	7: 113,329,878	S230T	possibly damaging	Het
Camta1	A	G	4: 151,078,969	S1479P	probably damaging	Het
Cd69	C	T	6: 129,270,062	S64N	probably benign	Het
Col5a1	T	C	2: 28,024,831	L153P	probably damaging	Het
Crat	C	A	2: 30,407,030	V304L	probably benign	Het
Csmd3	T	C	15: 47,847,131	T1687A	probably benign	Het
Dnah1	C	T	14: 31,276,158	G2574D	probably damaging	Het
Fau	T	C	19: 6,059,180	V86A	possibly damaging	Het
Garem1	T	G	18: 21,129,991	S589R	probably damaging	Het
Gbp3	T	G	3: 142,564,101		probably null	Het
Gin1	T	A	1: 97,783,016	S141R	possibly damaging	Het
Gtf2h1	A	T	7: 46,815,416	Q419L	possibly damaging	Het
Hipk3	A	G	2: 104,439,293	I517T	probably benign	Het
Hivep2	T	C	10: 14,131,878	S1407P	probably benign	Het
Hnrnpk	G	T	13: 58,395,177	D211E	probably benign	Het
Hnrnpul2	T	C	19: 8,826,801	L588P	probably damaging	Het
Il18rap	A	T	1: 40,525,058	H112L	probably benign	Het
Itgb1	T	G	8: 128,722,854	Y585D	possibly damaging	Het
Kmt2d	C	T	15: 98,854,278		probably benign	Het
Map7d1	A	T	4: 126,236,631		probably null	Het
Me2	A	G	18: 73,770,673	S575P	probably benign	Het
Med13l	A	G	5: 118,724,050	T353A	probably benign	Het
Mgat4b	T	C	11: 50,231,081	V143A	possibly damaging	Het
Mlxip	T	A	5: 123,442,306	W211R	probably damaging	Het
Morc2a	T	G	11: 3,685,907		probably null	Het
Muc4	A	T	16: 32,750,195		probably benign	Het
Ndufa10	A	T	1: 92,463,128	Y233*	probably null	Het
Nek8	C	T	11: 78,171,207	S237N	probably benign	Het
Neto1	G	A	18: 86,461,320	R211Q	probably benign	Het
Nfatc2ip	A	G	7: 126,391,335	S165P	probably benign	Het
Nsd2	A	G	5: 33,855,536	K404E	possibly damaging	Het
Nsd3	G	T	8: 25,659,854	E352*	probably null	Het
Nudt9	A	G	5: 104,047,106	T23A	probably benign	Het
Olfr394	T	C	11: 73,887,785	M196V	probably benign	Het
Olfr394	C	T	11: 73,887,830	V181I	probably benign	Het
Olfr983	A	G	9: 40,092,019	*312Q	probably null	Het
Patj	C	A	4: 98,667,648	Q297K	probably damaging	Het
Pelo	A	T	13: 115,088,903	C40*	probably null	Het
Pnpla3	G	A	15: 84,174,478		probably null	Het
Pramel1	C	A	4: 143,397,446	N230K	probably damaging	Het
Psg20	A	C	7: 18,682,507	L228R	probably damaging	Het
Rsph10b	T	C	5: 143,959,821	F44L	probably benign	Het
Sept2	G	A	1: 93,507,050	G358R	possibly damaging	Het
Slamf7	G	A	1: 171,648,931		probably benign	Het
Slc12a8	A	G	16: 33,608,213	D297G	probably damaging	Het
Slc17a5	G	A	9: 78,578,674	A43V	probably damaging	Het
Slc22a1	A	T	17: 12,662,596	F335L	probably benign	Het
Slc26a5	T	C	5: 21,834,347	N216S	probably damaging	Het
Snrnp27	T	C	6: 86,676,205	S144G	probably benign	Het
Spata20	T	A	11: 94,480,609	D643V	probably damaging	Het
Spata24	T	C	18: 35,660,462	K99R	probably damaging	Het
Taar5	A	G	10: 23,971,709	Y335C	probably damaging	Het
Tpr	A	G	1: 150,430,595	H1540R	probably benign	Het
Vmn1r27	A	G	6: 58,215,719	F100S	possibly damaging	Het
Vmn2r37	A	T	7: 9,217,783	Y360*	probably null	Het
Ybx1	C	A	4: 119,282,354	R36L	possibly damaging	Het
Zfp369	A	G	13: 65,297,202	K720E	probably benign	Het
Zfp599	A	G	9: 22,249,742	S376P	probably benign	Het
Zic2	A	G	14: 122,476,541	E289G	probably damaging	Het
Zzef1	T	C	11: 72,821,851	V199A	probably benign	Het

Other mutations in Arg2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01546:Arg2	APN	12	79149859	splice site	probably benign
IGL02494:Arg2	APN	12	79151923	missense	probably benign	0.00
IGL02512:Arg2	APN	12	79147743	missense	probably benign	0.01
IGL02543:Arg2	APN	12	79150759	missense	probably benign	0.02
IGL02974:Arg2	APN	12	79150792	missense	probably damaging	1.00
IGL03106:Arg2	APN	12	79149891	missense	probably damaging	0.99
IGL03240:Arg2	APN	12	79131831	splice site	probably null
R0119:Arg2	UTSW	12	79147612	missense	probably damaging	1.00
R0299:Arg2	UTSW	12	79147612	missense	probably damaging	1.00
R1856:Arg2	UTSW	12	79147662	missense	probably benign
R1863:Arg2	UTSW	12	79150020	nonsense	probably null
R4369:Arg2	UTSW	12	79149972	missense	probably damaging	0.99
R4901:Arg2	UTSW	12	79147711	missense	probably damaging	1.00
R7251:Arg2	UTSW	12	79150798	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGTCTCACTGTAACCCAGCCTCAG -3'
(R):5'- TGTGTTTAGAGTGTGGCCTCCACC -3'

Sequencing Primer
(F):5'- AGGCTAGACCCTGACTTTGC -3'
(R):5'- AGTCCTTGGGCTATGGAAATACC -3'

Posted On

2013-04-12